text2genome

About us

Related Links

Press Coverage

PubMed: 17222336    PubMedCentral: PMC1781469

Transcriptional profiling of the LPS induced NF-kappaB response in macrophages.

Sharif O, Bolshakov VN, Raines S, Newham P, Perkins ND
BMC immunology, 1 , 2007

Abstract:

BACKGROUND: Exposure of macrophages to bacterial products such as lipopolysaccharide (LPS) results in activation of the NF-kappaB transcription factor, which orchestrates a gene expression programme that underpins the macrophage-dependent immune response. These changes include the induction or repression of a wide range of genes that regulate inflammation, cell proliferation, migration and cell survival. This process is tightly regulated and loss of control is associated with conditions such as septic shock, inflammatory diseases and cancer. To study this response, it is important to have in vitro model systems that reflect the behaviour of cells in vivo. In addition, it is necessary to understand the natural differences that can occur between individuals. In this report, we have investigated and compared the LPS response in macrophage derived cell lines and peripheral blood mononuclear cell (PBMC) derived macrophages. RESULTS: Gene expression profiles were determined following LPS treatment of THP-1 cells for 1 and 4 hours. LPS significantly induced or repressed 72 out of 465 genes selected as being known or putative NF-kappaB target genes, which exhibited 4 temporal patterns of expression. Results for 34 of these genes, including several genes not previously identified as LPS target genes, were validated using real time PCR. A high correlation between microarray and real time PCR data was found. Significantly, the LPS induced expression profile of THP-1 cells, as determined using real time PCR, was found to be very similar to that of human PBMC derived macrophages. Interestingly, some differences were observed in the LPS response between the two donor PBMC macrophage populations. Surprisingly, we found that the LPS response in U937 cells was dramatically different to both THP-1 and PBMC derived macrophages. CONCLUSION: This study revealed a dynamic and diverse transcriptional response to LPS in macrophages, involving both the induction and repression of gene expression in a time dependent manner. Moreover, we demonstrated that the LPS induced transcriptional response in the THP-1 cell line is very similar to primary PBMC derived macrophages. Therefore, THP-1 cells represent a good model system for studying the mechanisms of LPS and NF-kappaB dependent gene expression.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:10135/PBEF1
EntrezGene:10322/SMYD5
EntrezGene:10628/TXNIP
EntrezGene:11168/PSIP1
EntrezGene:1435/CSF1
EntrezGene:23114/NFASC
EntrezGene:2597/GAPDH
EntrezGene:27250/PDCD4
EntrezGene:330/BIRC3
EntrezGene:3383/ICAM1
EntrezGene:3398/ID2
EntrezGene:3439/IFNA1
EntrezGene:3486/IGFBP3
EntrezGene:3557/IL1RN
EntrezGene:3576/IL8
EntrezGene:3627/CXCL10
EntrezGene:3661/IRF3
EntrezGene:3815/KIT
EntrezGene:4602/MYB
EntrezGene:4615/MYD88
EntrezGene:4693/NDP
EntrezGene:5366/PMAIP1
EntrezGene:5966/REL
EntrezGene:5970/RELA
EntrezGene:5971/RELB
EntrezGene:598/BCL2L1
EntrezGene:6348/CCL3
EntrezGene:6349/CCL3L1
EntrezGene:6351/CCL4
EntrezGene:6363/CCL19
EntrezGene:6648/SOD2
EntrezGene:7099/TLR4
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:7852/CXCR4
EntrezGene:8517/IKBKG
EntrezGene:958/CD40

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
SOD2 ENSG00000112096 1,2
IL1B ENSG00000125538 3,4
TNF ENSG00000204490 5,6
TNF ENSG00000206439 5,6
TNF ENSG00000223952 5,6
TNF ENSG00000228321 5,6
TNF ENSG00000228849 5,6
TNF ENSG00000230108 5,6
TNF ENSG00000232810 5,6
TXNIP ENSG00000117289 7,8
MYB ENSG00000118513 11,12
ID2 ENSG00000115738 13,14
BTG2 ENSG00000159388 15,16
GAPDH ENSG00000111640 18,17

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
9, 10 chr17:34416063-34417383
5, 6 HSCHR6_MHC_COX:31532370-31532714
5, 6 HSCHR6_MHC_QBL:31535201-31535545
13, 14 chr2:8822297-8822621
1, 2 chr6:160103623-160113786
5, 6 HSCHR6_MHC_DBB:31527102-31527446
10 chr17:34610773-34624325
3, 4 chr2:113588028-113591044
11, 12 chr6:135520099-135539050
17, 18 chr12:6645663-6646344
5, 6 chr6:31544958-31545302
7, 8 chr1:145440481-145441203
15, 16 chr1:203274744-203276566
5, 6 HSCHR6_MHC_SSTO:31534901-31535245
5, 6 HSCHR6_MHC_MCF:31621267-31621611
13, 14 chr3:62109956-62110280
5, 6 HSCHR6_MHC_MANN:31584445-31584789
5, 6 HSCHR6_MHC_APD:31556279-31556623

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1781469.pdf GATCCGCTGGGGACTTTCCAGCGC
1 PMC1781469.pdf CAGATCATGCAGCTGCACCAC
2 PMC1781469.pdf GTAGTAAGCGTGCTCCCACAC
3 PMC1781469.pdf GCCATGGACAAGCTGAGGAAG
4 PMC1781469.pdf GTGCTGATGTACCAGTTGGG
5 PMC1781469.pdf GCGTGGAGCTGAGAGATAACC
6 PMC1781469.pdf GATCCCAAAGTAGACCTGCCC
7 PMC1781469.pdf CTATCCTGGGCTGCAACATCC
8 PMC1781469.pdf GTTGAGGATGCAGGGATCCAC
9 PMC1781469.pdf CTTGCTGTCCTCCTCTGCAC
10 PMC1781469.pdf TCACTGGGGTCAGCACAGACC
11 PMC1781469.pdf ACTTCCACCCCCCTCATTGG
12 PMC1781469.pdf GCTCCTCCATCTTTCCACAGG
13 PMC1781469.pdf GAAAGCCTTCAGTCCCGTGAG
14 PMC1781469.pdf TCCGTGTTGAGGGTGGTCAG
15 PMC1781469.pdf GGAAGGGAACCGACATGCTC
16 PMC1781469.pdf CTAGCTGGAGACTGCCATCAC
17 PMC1781469.pdf GGTCGTATTGGGCGCCTGGTCACC
18 PMC1781469.pdf CACACCCATGACGAACATGGGGGC
Display recognized sequences in FASTA format