text2genome

About us

Related Links

Press Coverage

PubMed: 19590712    PubMedCentral: PMC2704330

Lansoprazole, a Proton Pump Inhibitor, Suppresses Production of Tumor Necrosis Factor-alpha and Interleukin-1beta Induced by Lipopolysaccharide and Helicobacter Pylori Bacterial Components in Human Monocytic Cells via Inhibition of Activation of Nuclear Factor-kappaB and Extracellular Signal-Regulated Kinase.

Tanigawa T, Watanabe T, Higuchi K, Machida H, Okazaki H, Yamagami H, Watanabe K, Tominaga K, Fujiwara Y, Oshitani N, Arakawa T
Journal of clinical biochemistry and nutrition, 86 , 2009

Abstract:

Pathogenic bacterial components play critical roles in initiation of gastrointestinal inflammation via activation of intracellular signaling pathways which induce proinflammatory cytokines such as tumor necrosis factor (TNF)-alpha and interleukin (IL)-1beta. Lansoprazole (LANSO), a proton pump inhibitor, has been widely used for the treatment of peptic ulcers and reflux esophagitis due to its potent acid-suppressive effect. It has also been reported to have anti-inflammatory effects. In this study we investigated the effects of LANSO on the production of TNF-alpha and IL-1beta induced by lipopolysaccharide (LPS) and Helicobacter pylori water-soluble extract (HpWE) in the human monocytic cell line (THP-1). LANSO (100 microM) significantly reduced mRNA expression and production of TNF-alpha and IL-1beta by THP-1 cells stimulated by LPS and HpWE. LANSO inhibited phosphorylation and degradation of inhibitory factor kappaB-alpha (IkappaB-alpha) and phosphorylation of extracellular signal-regulated kinase (ERK) induced by LPS and HpWE in THP-1 cells. These findings suggest that LANSO exerts anti-inflammatory effects by suppressing induction of TNF-alpha and IL-1beta via inhibition of nuclear factor (NF)-kappaB and ERK activation.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:2048/EPHB2
EntrezGene:21926/Tnf
EntrezGene:24835/TNFA_RAT
EntrezGene:2597/GAPDH
EntrezGene:5594/MAPK1
EntrezGene:57120/GOPC
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 0,1,2
Il1b ENSMUSG00000027398 3,4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1, 2 chr17:35336779-35336880
3, 4, 5 chr2:129192995-129193071

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2704330.pdf TCATGCACCACCATCAAGGA
1 PMC2704330.pdf GAGGCAACCTGACCACTCTCC
2 PMC2704330.pdf AATGGGCTTTCCGAATTCACTGGAGC
3 PMC2704330.pdf ACAGGCTCCGAGATGAACAAC
4 PMC2704330.pdf CCATTGAGGTGGAGAGCTTTC
5 PMC2704330.pdf AAAAAGCCTCGTGCTGTCGGACCCATAT
Display recognized sequences in FASTA format