text2genome

About us

Related Links

Press Coverage

PubMed: 11058144    PubMedCentral: PMC113163

PCR hot start using primers with the structure of molecular beacons (hairpin-like structure).

Kaboev OK, Luchkina LA, Tret'iakov AN, Bahrmand AR
Nucleic acids research, e94 , 2000

Abstract:

A new technique of PCR hot start using oligonucleotide primers with a stem-loop structure is developed here. The molecular beacon oligonucleotide structure without any chromophore addition to the ends was used. The 3'-end sequence of the primers was complementary to the target and five or six nucleotides complementary to the 3'-end were added to the 5'-end. During preparation of the reaction mixture and initial heating, the oligonucleotide has a stem-loop structure and cannot serve as an effective primer for DNA polymerase. After heating to the annealing temperature it acquires a linear structure and primer extension can begin.

Organism/Genes in external databases

Datasource Data

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 2,3

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2 chr17:7579562-7579584

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC113163.pdf TGGTCCTCGACGCGATCGAGC
1 PMC113163.pdf GCTCCTGGCTAGTGCATTGTCATAGGAGC
2 PMC113163.pdf TTGCCGTCCCAAGCAATGGATG
3 PMC113163.pdf GGCTGGTGCAAGTCACAGACTTGGCTG
4 PMC113163.pdf CCGACGTGCAAGTCACAGACTTGGCTG
Display recognized sequences in FASTA format