text2genome

About us

Related Links

Press Coverage

PubMed: 19753301    PubMedCentral: PMC2737626

Inhibitors of MyD88-dependent proinflammatory cytokine production identified utilizing a novel RNA interference screening approach.

Cho JS, Kim YC, Morrison SL
PloS one, , 2009

Abstract:

BACKGROUND: The events required to initiate host defenses against invading pathogens involve complex signaling cascades comprised of numerous adaptor molecules, kinases, and transcriptional elements, ultimately leading to the production of proinflammatory cytokines, such as tumor necrosis factor alpha (TNF-alpha). How these signaling cascades are regulated, and the proteins and regulatory elements participating are still poorly understood. RESULTS: We report here the development a completely random short-hairpin RNA (shRNA) library coupled with a novel forward genetic screening strategy to identify inhibitors of Toll-like receptor (TLR) dependent proinflammatory responses. We developed a murine macrophage reporter cell line stably transfected with a construct expressing diphtheria toxin-A (DT-A) under the control of the TNF-alpha-promoter. Stimulation of the reporter cell line with the TLR ligand lipopolysaccharide (LPS) resulted in DT-A induced cell death, which could be prevented by the addition of an shRNA targeting the TLR adaptor molecule MyD88. Utilizing this cell line, we screened a completely random lentiviral short hairpin RNA (shRNA) library for sequences that inhibited TLR-mediated TNF-alpha production. Recovery of shRNA sequences from surviving cells led to the identification of unique shRNA sequences that significantly inhibited TLR4-dependent TNF-alpha gene expression. Furthermore, these shRNA sequences specifically blocked TLR2 but not TLR3-dependent TNF-alpha production. CONCLUSIONS: Thus, we describe the generation of novel tools to facilitate large-scale forward genetic screens in mammalian cells and the identification of potent shRNA inhibitors of TLR2 and TLR4- dependent proinflammatory responses.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:4615/MYD88
EntrezGene:17874/Myd88
Genes found in fulltext (GNAT)
EntrezGene:12826/Col4a1
EntrezGene:1791/DNTT
EntrezGene:21926/Tnf
EntrezGene:2597/GAPDH
EntrezGene:3554/IL1R1
EntrezGene:3654/IRAK1
EntrezGene:3661/IRF3
EntrezGene:4615/MYD88
EntrezGene:57120/GOPC
EntrezGene:7097/TLR2
EntrezGene:7098/TLR3
EntrezGene:7099/TLR4
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7189/TRAF6
EntrezGene:9760/TOX

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 13,16

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
14, 15 chr10:39731761-39732461
14, 15 chr9:37493615-37494313
13, 16 chr17:35337815-35338785
14, 15 chr10:33528517-33529220
14, 15 chr6:84762323-84763023
14, 15 chr4:83750888-83751588
7 chr9:21311693-21311901

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2737626.pdf CAATCATCAGTGCTCCCCCGAAACGAGGTGCAATTTACGAAATTATAGATACGGGGTGAAGTACGGTGGAGTATAGGAAGTGTCCGTATGTAATGGAAGTTAATATGTGTTTTAGAATAACGATCAGTTATAGGAATAACGGTCAGTTATAGGAATACGTCATCAGGGTAGGAATAGAGTGCGTGAAGACGAATATTACGTAAGGTATGGAATATTACGTAAGGTATGGAATATTACGTAAGGTATGGAATATTACGTAAGGTATGGAATATTACGTAAGGTATGGAATATTACGTAAGGTATGGAATATTACGTAAGGTATGGAATATTACGTAAGGTATGGAATATTACGTAAGGTATGGAATCTCAGTATTGCAGTTGAATGGAAGTAATCGCGATGAATGTATGCAGTCTCAAAGAATGTATGCAGTCTCAAAGAATGTATGCAGTCTCAAAGAATGTATGCAGTCTCAAAGAATGTATGCAGTCTCAAAGAATGTATGCAGTCTCAAAGAATGTATGCAGTCTCAAAGAATGTATGCAGTCTCAAAGAATTGGGGTAAGTATGCTGAATTGTCGTATGGACACTGACAAGATCTTCATCCCATGACAAGGACTATGTGGGGGGACAGATGGGAAGTAAGAAGACAGGAGTTGGAGTGTCTGACAGTATTGAAGCTGACTGACATTAGTCTAGCAAATTGACATTAGTCTAGCAAATTGACCGAAATGTACGACCCCGACGCGCATCGAGGGTAAGGACGGACGTTTGTGTTGTAGACGGACGTTTGTGTTGTGGAGAAAGGCCTGCGTCTCTGAGAAAGGCCTGCGTCTCTGAGAAAGGCCTGCGTCTCTGAGACAGCGTCATCTCAAAGAGACGGGACACATACGAG
1 PMC2737626.pdf GAGCTAATCAGCATACAGTGAGCTAATCAGCATACAGTGAGGGAGATGGCAATTTTCGAGTACTACGTAAGGTATGGAGTATTACGTAAGGTATGGAGTATTACGTCTTCTAGAGATAATTTGGAAGTGCTTAGATAGATACAGCTCAAAATGATAGATACAGCTCAAAATGCATGATTGTCTCCTTGTTGCCAATTACGTAGTTATGAGATAGTTCCGCTTCTTTCGGATCAGGAGTCACAAAGTCGATCGCGTTCAGGTATTCAGATTAGTGACTAGTCATCAGATTATCACCCCATGCCGTGATTATCACCCCATGCCGTGATTGCAGCCGTAGATTAGGCAAACGGGCTTCGCAAGAGATAGTGCTACGGTATGTTGATAGTGCTACGGTATGTTGCCGACGTCTTAGTTCAATGCGGATCACTTCTTGTTCCGGACAAAGACAAGTTGTTAGGGAATTGTATTGAAGCTGGGGACGGCGTCCACGCTATGGGGAGTAGCATATTTAGCGGGGGAGTGAGTGAATGATGGGGGAGTGAGTGAATGATGGGGGAGTGAGTGAATGATGGGGGAGTGAGTGAATGATGGGGGAGTGAGTGAATGATGGGGGAGTGAGTGAATGATGGGGGAGTGAGTGAATGATGGGGGAGTGAGTGAATGATGGGGGAGTGAGTGAATGATGGGGGAGTGAGTGAATGATGGGGGAGTGAGTGAATGATGGGGGAGTGAGTGAATGATGGTATATAGGACGAGAACGGGTATGACTCAGTCCTCAGGGTAGAGGTACGCTTAGAAGGTAGAGGTACGCTTAGAAGGTGACCTTTCAGCGCAAAGGTGACCTTTCAGGGCAAAGGTGTGTTAGTGTCTCAAGGGTTGTATGCAGTCTCAAA
2 PMC2737626.pdf GTAAATATACCTGTCGTATGTAAATATTTGAATGTTTAGTAACTCGTGGTGCGTATAGTAAGTACGTTCCGTCAACGTACTAGGATTCGGGGTTCGTACTGCAGTTGCATACAGGTACTGCAGTTGCATACAGGTACTGCAGTTGCATACAGGTAGATCGCTCCACCCATGGTAGGTAAGTGTCTCAATGGTAGTATTGCTATTATGTCGTAGTATTGCTATTATGTCGTAGTATTGCTATTATGTCGTAGTTGGCACATGTACAGGTAGTTTTTTCGCTTCGCGGTTAGTTCTGTGTTCTCAGGTTAGTTCTGTGTTCTCAGGTTAGTTCTGTGTTCTCAGGTCATTTTCGTGCTCAGCAGTCGGATTTTAACAGTAAGGTGACAGAAAACACATACTGTGAGGTTGCATTATGTATGTGATCTATGTATATTGTAGTGATCTATGTATATTGTAGTGATCTATGTATATTGTAGTGATCTATGTATATTGTAGTGATCTATGTATATTGTAGTGATCTATGTATATTGTAGTGATCTATGTATATTGTAGTGATCTATGTATATTGTAGTGATCTATGTATATTGTAGTGATCTATGTATATTGTAGTGATGATAGGATCAATCTGTGATTCGTCCAAAAGCTTGTGGACTGAGGTGCTCAGGGTGGCGCAGAGTTACATGAGTTAATACGGATTCTCGAGGTTAATACGGATTCTCGAGGTTAGCGCTCTATACTCGTGTATGATGATAGATATTGGGTATGATTGTCTCCTTGTTGTCATGATTGGAAAGCTGTGTTATGTGGACCAAAGCTTGTTATGTGGACCAAAGCTTGTTCGGGTGAAGCACCAGGGTTTATGTCGTATGTGTTC
3 PMC2737626.pdf AGCTATAGTTTAGCGGCCGCTTATACTACTCAAAAAAAAAAAAAAAAAA
4 PMC2737626.pdf TTCAAGAGATGCATAGCTCCACATACTCCAGAATGACTTAATTCGTTAAGTCATTGTGGAGTATCTGGAGCTATGCATCTCTTGAA
5 PMC2737626.pdf TTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC
6 PMC2737626.pdf ATAGTTTAGCGGCCGCTTATACTACTCAAAAAAAAAAAAAAA
7 PMC2737626.pdf ATCGATTCTAGAAAGGTCGGGCAGGAAGAGGG
8 PMC2737626.pdf ATCGATCTCGAGAAAAATTCTCCGAACGTGTCACGTCTCTTGAACGTGACACGTTCGGAGAACGGTGTTTCGTCCTTTCCACAAG
9 PMC2737626.pdf ATCGATTCTAGAAAGGTCGGGCAGGAAGAGGG
10 PMC2737626.pdf GATCTCGAGAAAAAGCCAGCGAGCTAATTGAGAAACTCGAGTTTCTCAATTAGCTCGCTGGCCCGGTGTTTCGTCCTTTCCACAAG
11 PMC2737626.pdf ATCGATTCTAGAAAGGTCGGGCAGGAAGAGGG
12 PMC2737626.pdf ATGCATGGCGGTAATACGGTTATCC
13 PMC2737626.pdf TACAGGCTTGTCACTCGAATT
14 PMC2737626.pdf GTTGCCATCAATGACCCCTTCATTG
15 PMC2737626.pdf GCTTCACCACCTTCTTGATGTCATC
16 PMC2737626.pdf ATGAGCACAGAAAGCATGATC
Display recognized sequences in FASTA format