text2genome

About us

Related Links

Press Coverage

PubMed: 17250768    PubMedCentral: PMC1784079

Therapeutic effect of all-trans-retinoic acid (at-RA) on an autoimmune nephritis experimental model: role of the VLA-4 integrin.

Escribese MM, Conde E, Martín A, Sáenz-Morales D, Sancho D, Pérez de Lema G, Lucio-Cazaña J, Sánchez-Madrid F, García-Bermejo ML, Mampaso FM
BMC nephrology, 3 , 2007

Abstract:

BACKGROUND: Mercuric chloride (HgCl2) induces an autoimmune nephritis in the Brown Norway (BN) rats characterized by anti-glomerular basement membrane antibodies (anti-GBM Ab) deposition, proteinuria and a severe interstitial nephritis, all evident at day 13 of the disease. We assessed the effects of all-trans retinoic acid (at-RA) in this experimental model. At-RA is a vitamin A metabolite which has shown beneficial effects on several nephropathies, even though no clear targets for at-RA were provided. METHODS: We separated animals in four different experimental groups (HgCl2, HgCl2+at-RA, at-RA and vehicle). From each animal we collected, at days 0 and 13, numerous biological samples: urine, to measure proteinuria by colorimetry; blood to determine VLA-4 expression by flow citometry; renal tissue to study the expression of VCAM-1 by Western blot, the presence of cellular infiltrates by immunohistochemistry, the IgG deposition by immunofluorescence, and the cytokines expression by RT-PCR. Additionally, adhesion assays to VCAM-1 were performed using K562 alpha4 transfectant cells. ANOVA tests were used for statistical significance estimation. RESULTS: We found that at-RA significantly decreased the serum levels of anti-GBM and consequently its deposition along the glomerular membrane. At-RA markedly reduced proteinuria as well as the number of cellular infiltrates in the renal interstitium, the levels of TNF-alpha and IL-1beta cytokines and VCAM-1 expression in renal tissue. Moreover, we reported here for the first time in an in vivo model that at-RA reduced, to basal levels, the expression of VLA-4 (alpha4beta1) integrin induced by mercury on peripheral blood leukocytes (PBLs). In addition, using K562 alpha4 stable transfectant cells, we found that at-RA inhibited VLA-4 dependent cell adhesion to VCAM-1. CONCLUSION: Here we demonstrate a therapeutic effect of at-RA on an autoimmune experimental nephritis model in rats. We report a significant reduction of the VLA-4 integrin expression on PBLs as well as the inhibition of the VLA4/VCAM1-dependent leukocyte adhesion by at-RA treatment. Thereby we point out the VLA-4 integrin as a target for at-RA in vivo.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1773/DNASE1
EntrezGene:24835/TNFA_RAT
EntrezGene:25361/VCAM1_RAT
EntrezGene:283297/OR10A4
EntrezGene:287435/NP_001026808.1
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:7412/VCAM1
EntrezGene:788/SLC25A20

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
IL1B_RAT ENSRNOG00000004649 2,3
TNFA_RAT ENSRNOG00000000837 4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0 chr12:12049157-12049182
4, 5 chr20:3662569-3662656
2, 3 chr3:116964884-116964963

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1784079.pdf ATGCCATCCTGCGTCTGGACCTGGC
1 PMC1784079.pdf AGCATTTGCGGTGCACGATGGC
2 PMC1784079.pdf CACCTCTCAAGCAGAGCACAG
3 PMC1784079.pdf GGGTTCCATGGTGAAGTCAAC
4 PMC1784079.pdf CCAGGAGAAAGTCAGCCTCCT
5 PMC1784079.pdf TCATACCAGGGCTTGAGCTCA
Display recognized sequences in FASTA format