text2genome

About us

Related Links

Press Coverage

PubMed: 17392580    PubMedCentral: PMC1657076

Effects of Ginkgo biloba extract on inflammatory mediators (SOD, MDA, TNF-alpha, NF-kappaBp65, IL-6) in TNBS-induced colitis in rats.

Zhou YH, Yu JP, Liu YF, Teng XJ, Ming M, Lv P, An P, Liu SQ, Yu HG
Mediators of inflammation, , 2006

Abstract:

Inflammatory mediators play a critical role in ulcerative colitis immune and inflammatory processes. The aim of the study was to investigate the effects of Ginkgo biloba extract on inflammatory mediators (SOD, MDA, TNF-alpha, NF-kappaBp65, IL-6) in TNBS-induced colitis in rats. Colitis in rats was induced by colonic administration with 2,4,6-trinitrobenzene sulfonic acid (TNBS, 150 mg/kg). EGB in doses of (50, 100, 200 mg/kg) was administered for 4 weeks to protect colitis. The results showed that EGB could significantly ameliorate macroscopic and histological damage, evidently elevate the activities of SOD and reduce the contents of MDA, inhibit the protein and mRNA expressions of TNF-alpha, NF-kappaBp65, and IL-6 in the colon tissues of experimental colitis in a dose-dependent manner compared with the model group. We concluded that the probable mechanisms of EGB ameliorated inflammatory injury in TNBS-induced colitis in rats by its modulation of inflammatory mediators and antioxidation.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:24835/TNFA_RAT
EntrezGene:2597/GAPDH
EntrezGene:3383/ICAM1
EntrezGene:3558/IL2
EntrezGene:3576/IL8
EntrezGene:3815/KIT
EntrezGene:5599/MAPK8
EntrezGene:6098/ROS1
EntrezGene:6351/CCL4
EntrezGene:6647/SOD1
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
NP_954888.1 ENSRNOG00000030888 0,1
TNFA_RAT ENSRNOG00000000837 2,3
IL6_RAT ENSRNOG00000010278 4,5
G3P_RAT ENSRNOG00000018630 6,7

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3 chr20:3662423-3662780
6, 7 chr11:70680156-70680464
6, 7 chr1:189772362-189772670
6, 7 chr8:105552831-105553138
6, 7 chr10:71195501-71195810
5 chr4:457215-457235
6, 7 chr5:37434397-37434704
6, 7 chr5:57052162-57052470
6, 7 chr2:19339373-19339680
6, 7 chr14:43415645-43415952
6, 7 chr7:34078481-34078789
6, 7 chr5:11427597-11427905
6, 7 chr14:43239406-43239713
6, 7 chr16:25751613-25751921
6, 7 chr8:44322142-44322450
6, 7 chr6:54668002-54668298
6, 7 chr5:117080694-117081002
6, 7 chr5:73006517-73006825
6, 7 chr13:87367311-87367619
6, 7 chr3:127118364-127118672
6, 7 chr4:161282886-161283306
6, 7 chr10:25793872-25794180

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1657076.pdf AAGATCAATGGCTACACGGG
1 PMC1657076.pdf CCTCAATGTCTTCTTTCTGC
2 PMC1657076.pdf GCCAATGGCATGGATCTCAAAG
3 PMC1657076.pdf CAGAGCAATGACTCCAAAGT
4 PMC1657076.pdf TCTCTCCGCAAGAGACTTCC
5 PMC1657076.pdf TCTTGGTCCTTAGCCACTCC
6 PMC1657076.pdf TCCCTCAAGATTGTCAGCAA
7 PMC1657076.pdf AGATCCACAACGGATACATT
Display recognized sequences in FASTA format