text2genome

About us

Related Links

Press Coverage

PubMed: 19883508    PubMedCentral: PMC2775725

RNAi mediated acute depletion of retinoblastoma protein (pRb) promotes aneuploidy in human primary cells via micronuclei formation.

Amato A, Lentini L, Schillaci T, Iovino F, Di Leonardo A
BMC cell biology, 79 , 2009

Abstract:

BACKGROUND: Changes in chromosome number or structure as well as supernumerary centrosomes and multipolar mitoses are commonly observed in human tumors. Thus, centrosome amplification and mitotic checkpoint dysfunctions are believed possible causes of chromosomal instability. The Retinoblastoma tumor suppressor (RB) participates in the regulation of synchrony between DNA synthesis and centrosome duplication and it is involved in transcription regulation of some mitotic genes. Primary human fibroblasts were transfected transiently with short interfering RNA (siRNA) specific for human pRb to investigate the effects of pRb acute loss on chromosomal stability. RESULTS: Acutely pRb-depleted fibroblasts showed altered expression of genes necessary for cell cycle progression, centrosome homeostasis, kinetochore and mitotic checkpoint proteins. Despite altered expression of genes involved in the Spindle Assembly Checkpoint (SAC) the checkpoint seemed to function properly in pRb-depleted fibroblasts. In particular AURORA-A and PLK1 overexpression suggested that these two genes might have a role in the observed genomic instability. However, when they were post-transcriptionally silenced in pRb-depleted fibroblasts we did not observe reduction in the number of aneuploid cells. This finding suggests that overexpression of these two genes did not contribute to genomic instability triggered by RB acute loss although it affected cell proliferation. Acutely pRb-depleted human fibroblasts showed the presence of micronuclei containing whole chromosomes besides the presence of supernumerary centrosomes and aneuploidy. CONCLUSION: Here we show for the first time that RB acute loss triggers centrosome amplification and aneuploidy in human primary fibroblasts. Altogether, our results suggest that pRb-depleted primary human fibroblasts possess an intact spindle checkpoint and that micronuclei, likely caused by mis-attached kinetochores that in turn trigger chromosome segregation errors, are responsible for aneuploidy in primary human fibroblasts where pRb is acutely depleted.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:5925/RB1
Species found in fulltext (Linnaeus)
Homo sapiens
Mus musculus
Armoracia rusticana
Capra hircus
Oryctolagus cuniculus
Lateolabrax japonicus
Human papillomavirus type 16
Genes found in fulltext (GNAT)
EntrezGene:1058/CENPA
EntrezGene:1062/CENPE
EntrezGene:1063/CENPF
EntrezGene:12236/Bub1b
EntrezGene:1871/E2F3
EntrezGene:19645/Rb1
EntrezGene:2597/GAPDH
EntrezGene:3815/KIT
EntrezGene:4085/MAD2L1
EntrezGene:5347/PLK1
EntrezGene:5451/POU2F1
EntrezGene:55294/FBXW7
EntrezGene:56150/Mad2l1
EntrezGene:57162/PELI1
EntrezGene:5925/RB1
EntrezGene:672/BRCA1
EntrezGene:6790/AURKA
EntrezGene:701/BUB1B
EntrezGene:7157/TP53
EntrezGene:8379/MAD1L1
EntrezGene:8900/CCNA1
EntrezGene:991/CDC20

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
GAPDH ENSG00000111640 0,20,1,19
AURKA ENSG00000087586 2,3
PLK1 ENSG00000166851 4,5
MAD2L1 ENSG00000164109 6,7
RB1 ENSG00000139687 8,9,18
BRCA1 ENSG00000012048 10,11
TP53 ENSG00000141510 12,13
PTTG1 ENSG00000164611 14,15
BUB1B ENSG00000156970 23,24

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
21 chr12:133434006-133434031
2, 3 chr20:54945551-54948517
6 chr14:61246766-61246786
1, 19, 20 chr12:6646773-6647305
4, 5 chr16:23700040-23700837
15 chr5:159849372-159849393
11 chr17:41199666-41199686
9, 18 chr13:49027153-49039383
12 chr17:7578193-7578214
16 chr1:43826578-43826603
16 chr9:89627592-89627617
0 chr6:166478296-166478317
23, 24 chr15:40462287-40462847
7 chr4:120986924-120986946

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2775725.pdf CTCATGACCACAGTCCATGCC
1 PMC2775725.pdf CATCCACAGTCTTCTGGGT
2 PMC2775725.pdf TTTTGTAGGTCTCTTGGTATGTG
3 PMC2775725.pdf TGGAGAGCTTAAAATTGCAG
4 PMC2775725.pdf CGGAAATATTTAAGGAGGGTGA
5 PMC2775725.pdf GGACTATTCGGACAAGTACG
6 PMC2775725.pdf CTCATTCGGCATCAACAGCA
7 PMC2775725.pdf TCAGATGGATATATGCCACGCT
8 PMC2775725.pdf GCAGTATGCTTCCACCAGGC
9 PMC2775725.pdf AAGGGCTTCGAGGAATGTGAG
10 PMC2775725.pdf CCTTGGCACAGGTGTCCAC
11 PMC2775725.pdf GCCATTGTCCTCTGTCCAGG
12 PMC2775725.pdf TTCGACATAGTGTGGTGGTGC
13 PMC2775725.pdf AGTCAGAGCCAACCTCAGGC
14 PMC2775725.pdf CGGCTGTTAAGACCTGCAATAATC
15 PMC2775725.pdf TTCAGCCCATCCTTAGCAACC
16 PMC2775725.pdf GAGGGTGGCTGGGTTCCTCTCAGATGCGAATGTGTCGATCA
17 PMC2775725.pdf CAGGGTTGTGAAATTGGATCA
18 PMC2775725.pdf GGTCCTTCTCGGTCCTTTGATTGTT
19 PMC2775725.pdf TGACATCAAGAAGGTGGTGA
20 PMC2775725.pdf TCCACCACCCTGTTGCTGTA
21 PMC2775725.pdf CCTCAACAACCTCGTGGAAGCATAC
22 PMC2775725.pdf TCCTGGCATCCATACTTTGCACATC
23 PMC2775725.pdf TACACTGGAAATGACCCTCTGGAT
24 PMC2775725.pdf TATAATATCGTTTTTCTCCTTGTAGTGCT
Display recognized sequences in FASTA format