text2genome

About us

Related Links

Press Coverage

PubMed: 18267006    PubMedCentral: PMC2275277

Adjuvant interferon gamma in patients with pulmonary atypical Mycobacteriosis: a randomized, double-blind, placebo-controlled study.

Milanés-Virelles MT, García-García I, Santos-Herrera Y, Valdés-Quintana M, Valenzuela-Silva CM, Jiménez-Madrigal G, Ramos-Gómez TI, Bello-Rivero I, Fernández-Olivera N, Sánchez-de la Osa RB, Rodríguez-Acosta C, González-Méndez L, Martínez-Sánchez G, López-Saura PA, MACGAM Study Group
BMC infectious diseases, 17 , 2008

Abstract:

BACKGROUND: High antibiotic resistance is described in atypical Mycobacteriosis, mainly by Mycobacterium avium complex (MAC). METHODS: A randomized, double-blind, placebo-controlled clinical trial was carried out in two hospitals to evaluate the effect of interferon (IFN) gamma as immunoadjuvant to chemotherapy on patients with atypical mycobacteria lung disease. Patients received placebo or 1 x 106 IU recombinant human IFN gamma intramuscularly, daily for one month and then three times per week up to 6 months as adjuvant to daily oral azithromycin, ciprofloxacin, ethambutol and rifampin. Sputum samples collection for direct smear observation and culture as well as clinical and thorax radiography assessments were done during treatment and one year after. Cytokines and oxidative stress determinations were carried out in peripheral blood before and after treatment. RESULTS: Eighteen patients were included in the IFN group and 14 received placebo. Groups were homogeneous at entry; average age was 60 years, 75% men, 84% white; MAC infection prevailed (94%). At the end of treatment, 72% of patients treated with IFN gamma were evaluated as complete responders, but only 36% in the placebo group. The difference was maintained during follow-up. A more rapid complete response was obtained in the IFN group (5 months before), with a significantly earlier improvement in respiratory symptoms and pulmonary lesions reduction. Disease-related deaths were 35.7% of the patients in the placebo group and only 11.1% in the IFN group. Three patients in the IFN group normalized their globular sedimentation rate values. Although differences in bacteriology were not significant during the treatment period, some patients in the placebo group converted again to positive during follow-up. Significant increments in serum TGF-beta and advanced oxidation protein products were observed in the placebo group but not among IFN receiving patients. Treatments were well tolerated. Flu-like symptoms predominated in the IFN gamma group. No severe events were recorded. CONCLUSION: These data suggest that IFN gamma is useful and well tolerated as adjuvant therapy in patients with pulmonary atypical Mycobacteriosis, predominantly MAC. Further wider clinical trials are encouraged. TRIAL REGISTRATION: Current Controlled Trials ISRCTN70900209.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1075/CTSC
EntrezGene:10903/MTMR11
EntrezGene:183/AGT
EntrezGene:25801/GCA
EntrezGene:2597/GAPDH
EntrezGene:31/ACACA
EntrezGene:6347/CCL2
EntrezGene:6646/SOAT1
EntrezGene:6647/SOD1
EntrezGene:6898/TAT
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:788/SLC25A20

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
IFNG ENSG00000111537 1,2
TNF ENSG00000204490 3,4
TNF ENSG00000206439 3,4
TNF ENSG00000223952 3,4
TNF ENSG00000228321 3,4
TNF ENSG00000228849 3,4
TNF ENSG00000230108 3,4
TNF ENSG00000232810 3,4
CCL2 ENSG00000108691 7,8

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
3, 4 HSCHR6_MHC_COX:31530860-31532391
0 chr5:159378003-159378023
0 chr6:84102618-84102638
3, 4 HSCHR6_MHC_QBL:31533689-31535222
0 chr22:41069954-41069974
0 chrX:39646885-39646905
3, 4 HSCHR6_MHC_MANN:31582935-31584466
0 chr2:3736070-3736090
1, 2 chr12:68549139-68553395
0 chr8:97081465-97081485
0 chr1:120038958-120038978
12 chr1:206941867-206941890
7, 8 chr17:32582340-32583776
0 chr18:3978126-3978146
3, 4 HSCHR6_MHC_MCF:31619757-31621288
0 chr12:6646516-6646536
0 chr1:32868214-32868234
5 chr19:41854324-41854344
0 chr6:57687460-57687480
0 chrX:46299643-46299663
3, 4 chr6:31543448-31544979
0 chr15:64821364-64821384
0 chr9:103738437-103738457
13 chr17:45820035-45820057
3, 4 HSCHR6_MHC_DBB:31525592-31527123
3, 4 HSCHR6_MHC_SSTO:31533391-31534922

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2275277.pdf CAAAGTTGTCATGGATGACC
1 PMC2275277.pdf ATGAAATATACAAGTTATATCTTGGCTTT
2 PMC2275277.pdf GATGCTCTTCGACCTCGAAACAGCAT
3 PMC2275277.pdf TGCCAGGCAGGTTCTCTTCCCG
4 PMC2275277.pdf GGTTATCTCTCAGCTCCACGCCA
5 PMC2275277.pdf CAAGCAGAGTACACACAGCA
6 PMC2275277.pdf GATGCTGGGCCCTCTCAAGC
7 PMC2275277.pdf AACTGAAGCTCGCACTCTCG
8 PMC2275277.pdf TCAGCACAGATCTCCTTGGC
9 PMC2275277.pdf AAGGTGGCAGGATGTCTCGTG
10 PMC2275277.pdf TGGTCTCGTGTTCTTCTGTTCTG
11 PMC2275277.pdf AACAAGACCCAGACATCAAG
12 PMC2275277.pdf GAGGTACAATAAGGTTTCTCAAG
13 PMC2275277.pdf GATGTTTGTGGACGTGGTCTTG
14 PMC2275277.pdf GATGTTTGTGGACGTGGTCTTG
Display recognized sequences in FASTA format