text2genome

About us

Related Links

Press Coverage

PubMed: 7479059    PubMedCentral: PMC307337

Species- and tissue-specific expression of the C-terminal alternatively spliced form of the tumor suppressor p53.

Will K, Warnecke G, Bergmann S, Deppert W
Nucleic acids research, 4023 , 1995

Abstract:

Alternative splicing of the p53 transcript which so far has been demonstrated only in the murine system has been proposed as a general regulatory mechanism for the generation of functionally different p53 proteins. We analyzed by RT-PCR the pattern of p53 mRNAs within the region spanning exons 10 and 11 of the p53 gene in 13 different tissues from two independent mouse strains, in 10 different rat tissues and in six different human tissues. PCR products of the expected sizes, corresponding to the normally spliced and the alternatively spliced p53 mRNAs, were detected in mice. Alternatively spliced mRNA was found at approximately 25-20% the level of the normally spliced p53 mRNA in most tissues analyzed. In spleen and kidney the proportion of alternatively spliced p53 mRNA was much lower. Surprisingly, examination of p53 mRNAs isolated from 10 different rat tissues and six human tissues within the same region of the p53 gene showed only products of normal size. Although a potential homologous alternative 3' splice site within intron 10 of the human p53 gene is present in the genomic sequence of human p53, the expected corresponding alternatively spliced p53 mRNA was undetectable. These findings imply that the generation of functionally different forms of p53 by alternative splicing of p53 transcripts is a species-specific event, possibly indicating species-specific mechanisms for regulating p53 activities.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:22059/Trp53
Genes found in fulltext (GNAT)
EntrezGene:13132/Dab2
EntrezGene:14433/380687-208
EntrezGene:22059/Trp53
EntrezGene:24842/P53_RAT
EntrezGene:2597/GAPDH
EntrezGene:57120/GOPC
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 2,5,6

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 5, 6 chr17:7572897-7574009

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC307337.txt CGAAAGCTTAGGCCCCTCCTGTTATT
1 PMC307337.txt CGAGGATCCACAGCCGCATCTTCTTGT
2 PMC307337.txt TGTCAGTGGGGAACAAGAAGTGG
3 PMC307337.txt GGACTAGCATTGTCTTGTCAGC
4 PMC307337.txt AGTCGGATCCAGGGTGGGGGGTGGATA
5 PMC307337.txt TGGAACTCAAGGATGCCCAGG
6 PMC307337.txt ATGTTCCGAGAGCTGAATGAGG
7 PMC307337.txt AGTCGAATTCAAGGATGCCCATGCTAC
8 PMC307337.txt GCTTCCTCCTTGATCAAGG
9 PMC307337.txt TCCCTGACCAATGCTTGAAGG
Display recognized sequences in FASTA format