text2genome

About us

Related Links

Press Coverage

PubMed: 16446781    PubMedCentral: PMC1352391

Rapid and simple comparison of messenger RNA levels using real-time PCR.

Dussault AA, Pouliot M
Biological procedures online, 1 , 2006

Abstract:

Real-time polymerase chain reaction (PCR) constitutes a significant improvement over traditional end-point PCR, as it allows the quantification of starting amounts of nucleic acid templates, in real-time. However, quantification requires validation through numerous internal controls and standard curves. We describe in this paper a simple protocol which uses real-time PCR to compare mRNA levels of a gene of interest between different experimental conditions. Comparative real-time PCR can be a relatively low-cost method and does not require sequence-specific fluorescent reporters. Moreover, several genes from a set of experiments can be assessed in a single run. Thus, in addition to providing a comparative profile for the expression of a gene of interest, this method can also provide information regarding the relative abundance of different mRNA species.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:2597/GAPDH
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
GAPDH ENSG00000111640 0,1
PTGS2 ENSG00000073756 2,3
IL1B ENSG00000125538 5,4
IL1RN ENSG00000136689 6,7
IL6 ENSG00000136244 9,8
IL8 ENSG00000169429 10,11
TNF ENSG00000204490 12,13
TNF ENSG00000206439 12,13
TNF ENSG00000223952 12,13
TNF ENSG00000228321 12,13
TNF ENSG00000228849 12,13
TNF ENSG00000230108 12,13
TNF ENSG00000232810 12,13
CCL3L1 ENSG00000205021 14,15
CXCL2 ENSG00000081041 18,19
CCL19 ENSG00000172724 20,21
CCL20 ENSG00000115009 22,23
CCL2 ENSG00000108691 24,25

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
13 HSCHR6_MHC_MCF:31621301-31621321
13 HSCHR6_MHC_APD:31556313-31556333
8, 9 chr7:22767169-22768364
2, 3 chr1:186645990-186646868
13 HSCHR6_MHC_QBL:31535235-31535255
13 HSCHR6_MHC_COX:31532404-31532424
18, 19 chr4:74964366-74964594
22, 23 chr2:228680171-228681059
6, 7 chr2:113890254-113890408
13 HSCHR6_MHC_MANN:31584479-31584499
13 HSCHR6_MHC_SSTO:31534935-31534955
24, 25 chr17:32583329-32583831
15, 16, 17 chr17:34416047-34432640
4, 5 chr2:113590372-113591039
13 chr6:31544992-31545012
10, 11 chr4:74607258-74607725
15, 16 chr17:34610757-34640132
13 HSCHR6_MHC_DBB:31527136-31527156
0, 1 chr12:6646086-6646346

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1352391.pdf CGAGATCCCTCCAAAATCAA
1 PMC1352391.pdf TTCACACCCATGACGAACAT
2 PMC1352391.pdf TGCATTCTTTGCCCAGCACT
3 PMC1352391.pdf AAAGGCGCAGTTTACGCTGT
4 PMC1352391.pdf GGACAAGCTGAGGAAGATGC
5 PMC1352391.pdf TCGTTATCCCATGTGTCGAA
6 PMC1352391.pdf GCGAGAACAGAAAGCAGGAC
7 PMC1352391.pdf CCTTCGTCAGGCATATTGGT
8 PMC1352391.pdf CACAGACAGCCACTCACCTC
9 PMC1352391.pdf TTTTCTGCCAGTGCCTCTTT
10 PMC1352391.pdf GTGCAGTTTTGCCAAGGAGT
11 PMC1352391.pdf CTCTGCACCCAGTTTTCCTT
12 PMC1352391.pdf AGCCCATGTTGTAGCAAACC
13 PMC1352391.pdf TGAGGTACAGGCCCTCTGAT
14 PMC1352391.pdf CTCTGCAACCAGGTCCTCTC
15 PMC1352391.pdf TTTCTGGACCCACTCCTCAC
16 PMC1352391.pdf AAGCTCTGCGTGACTGTCCT
17 PMC1352391.pdf GCTTGCTTCTTTTGGTTTGG
18 PMC1352391.pdf TGCAGGGAATTCACCTCAAG
19 PMC1352391.pdf TGAGACAAGCTTTCTGCCCA
20 PMC1352391.pdf GGTGCCTGCTGTAGTGTTCA
21 PMC1352391.pdf GCTTCATCTTGGCTGAGGTC
22 PMC1352391.pdf GCAAGCAACTTTGACTGCTG
23 PMC1352391.pdf ATTTGCGCACACAGACAACT
24 PMC1352391.pdf AGCAGCAAGTGTCCCAAAGA
25 PMC1352391.pdf TTGGGTTTGCTTGTCCAGGT
Display recognized sequences in FASTA format