text2genome

About us

Related Links

Press Coverage

PubMed: 19696902    PubMedCentral: PMC2729098

Effect of food restriction on adipose tissue in spontaneously diabetic Torii fatty rats.

Morinaga H, Ohta T, Matsui K, Sasase T, Fukuda S, Ito M, Ueda M, Ishii Y, Miyajima K, Matsushita M
Experimental diabetes research, , 2009

Abstract:

Spontaneously Diabetic Torii-fa/fa (SDT fatty) rat is a new model of obese type 2 diabetes. SDT fatty rat exhibits obesity associated with hyperphagia. In this study, SDT fatty rats were subjected to pair-feeding with SDT-+/+ (SDT) rats from 6 to 22 weeks of age. The ratio of visceral fat weight to subcutaneous fat weight (V/S) decreased at 12 weeks of age in the pair-feeding rats. The intraperitoneal fat weight such as epididymal and retroperitoneal fat weight decreased, whereas mesenteric fat weight had no change. Cell size of the epididymal fat in the pair-feeding rats tended to decrease. Glucose oxidation level in epididymal fat in the pair-feeding rats at 12 weeks of age was recovered to a similar level with that in SDT rats. These results indicated that SDT fatty rat is a useful model to evaluate the functional or the morphological features in adipose tissue and develop a novel drug for antiobesity.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:25139/GTR4_RAT
EntrezGene:25608/LEP_RAT
EntrezGene:3952/LEP
EntrezGene:4023/LPL
EntrezGene:58959/CRFR1_RAT
EntrezGene:6517/SLC2A4
EntrezGene:9370/ADIPOQ

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
GTR4_RAT ENSRNOG00000017226 0,1
TNFA_RAT ENSRNOG00000000837 2,3
LIPL_RAT ENSRNOG00000012181 5,6,7
ACACA_RAT ENSRNOG00000034013 8,9,10

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
8, 9, 10 chr10:72577624-72582955
2, 3 chr20:3662491-3662576
0 chr10:56789536-56789558
5, 6, 7 chr16:22546064-22550129

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2729098.pdf AGTGCATCAGACACATCAGCCC
1 PMC2729098.pdf TGCCCGAAAGAGTCTAAAGCG
2 PMC2729098.pdf CCAGGTTCTCTTCAAGGGACAA
3 PMC2729098.pdf CTCCTGGTATGAAATGGCAAATC
4 PMC2729098.pdf CCCGACTATGTGTGCTCCTCACCCACA
5 PMC2729098.pdf TGTCTAACTGCCACTTCAACCACA
6 PMC2729098.pdf CATACATTCCTGTCACCGTCCA
7 PMC2729098.pdf CAGCAAAACCTTTGTGGTGATCCATGG
8 PMC2729098.pdf GCAGCTATGTTCAGAGAGTTCACC
9 PMC2729098.pdf CCACCTCACAGTTGACTTGTTTTC
10 PMC2729098.pdf CGGCGACTTACGTTCCTAGTTGCACAAAA
Display recognized sequences in FASTA format