text2genome

About us

Related Links

Press Coverage

PubMed: 19234608    PubMedCentral: PMC2642995

Tomato lycopene extract prevents lipopolysaccharide-induced NF-kappaB signaling but worsens dextran sulfate sodium-induced colitis in NF-kappaBEGFP mice.

Joo YE, Karrasch T, Mühlbauer M, Allard B, Narula A, Herfarth HH, Jobin C
PloS one, , 2009

Abstract:

BACKGROUND: The impact of tomato lycopene extract (TLE) on intestinal inflammation is currently unknown. We investigated the effect of TLE on lipopolysaccharide (LPS)-induced innate signaling and experimental colitis. METHODOLOGY/PRINCIPAL FINDINGS: Mice were fed a diet containing 0.5 and 2% TLE or isoflavone free control (AIN-76). The therapeutic efficacy of TLE diet was assessed using dextran sulfate sodium (DSS) exposed mice and IL-10(-/-);NF-kappaB(EGFP) mice, representing an acute and spontaneous chronic colitis model respectively. A mini-endoscope was used to determine the extent of macroscopic mucosal lesions. Murine splenocytes and intestinal epithelial cells were used to determine the in vitro impact of TLE on LPS-induced NF-kappaB signaling. In vitro, TLE blocked LPS-induced IkappaBalpha degradation, RelA translocation, NF-kappaB transcriptional activity and MIP-2 mRNA accumulation in IEC-18 cells. Moreover, LPS-induced IL-12p40 gene expression was dose-dependently inhibited in TLE-treated splenocytes. Interestingly, DSS-induced acute colitis worsened in TLE-fed NF-kappaB(EGFP) mice compared to control diet as measured by weight loss, colonoscopic analysis and histological scores. In contrast, TLE-fed IL-10(-/-);NF-kappaB(EGFP) mice displayed decreased colonic EGFP expression compared to control diet. IL-6, TNFalpha, and MCP-1 mRNA expression were increased in the colon of TLE-fed, DSS-exposed NF-kappaB(EGFP) mice compared to the control diet. Additionally, caspase-3 activation and TUNEL positive cells were enhanced in TLE diet-fed, DSS-exposed mice as compared to DSS control mice. CONCLUSIONS/ SIGNIFICANCE: These results indicate that TLE prevents LPS-induced proinflammatory gene expression by blocking of NF-kappaB signaling, but aggravates DSS-induced colitis by enhancing epithelial cell apoptosis.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:16153/Il10
EntrezGene:17874/Myd88
EntrezGene:18033/Nfkb1
Species found in fulltext (Linnaeus)
Solanum lycopersicum
Mus sp.
Prunus armeniaca
Carica papaya
Citrullus lanatus subsp. vulgaris
Mus musculus
Rattus norvegicus
Escherichia coli
Homo sapiens
Rosmarinus officinalis
Genes found in fulltext (GNAT)
EntrezGene:114105/CXCL2_RAT
EntrezGene:12367/Casp3
EntrezGene:16193/Il6
EntrezGene:3569/IL6
EntrezGene:4858/NOVA2
EntrezGene:5970/RELA
EntrezGene:6366/CCL21

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Il12b ENSMUSG00000004296 2,3
Tnf ENSMUSG00000024401 4,5
Gapdh ENSMUSG00000057666 10,11

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
10, 11 chr2:43374676-43374916
10, 11 chr13:99172796-99173036
10, 11 chr4:84569845-84570091
10, 11 chr3:139312344-139312584
10, 11 chr4:91519118-91519358
10, 11 chr14:12114205-12114445
10, 11 chr12:71022133-71022476
10, 11 chr8:77930176-77930416
10, 11 chrX:77439949-77440189
10, 11 chr11:26686634-26686874
10, 11 chr10:33529062-33529302
10, 11 chr7:96756217-96756446
10, 11 chr4:57384584-57384824
1 chr5:91334311-91334332
10, 11 chr3:78721181-78721421
10, 11 chr3:52416758-52416998
10, 11 chr15:12504645-12504885
10, 11 chr11:20235774-20236014
8, 9 chr11:81849588-81850676
10, 11 chr5:106292479-106292719
7 chr5:30344622-30344645
2, 3 chr11:44222053-44224564
10, 11 chr8:95240585-95240825
10, 11 chr2:11331416-11331656
10, 11 chr2:28789887-28790127
10, 11 chr6:91378878-91379118
10, 11 chr12:5597182-5597428
10, 11 chr18:54143976-54144222
10, 11 chr14:103770441-103770661
10, 11 chr7:59002068-59002308
10, 11 chr3:142625576-142625816
10, 11 chr5:96290734-96290974
10, 11 chr2:151199745-151199991
10, 11 chr8:60029100-60029340
10, 11 chr6:128153009-128153249
10, 11 chr5:13043192-13043432
10, 11 chr3:121933872-121934112
10, 11 chr7:107910078-107910318
10, 11 chr6:83825132-83825372
4, 5 chr17:35337815-35338785
10, 11 chr9:51430850-51431096

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2642995.pdf ACCCTACCAAGGGTTGACTTC
1 PMC2642995.pdf GGCACATCAGGTACGATCCAG
2 PMC2642995.pdf GAAGTTCAACATCAAGAGCAGTAG
3 PMC2642995.pdf AGGGAGAAGTAGGAATGGGG
4 PMC2642995.pdf ATGAGCACAGAAAGCATGATC
5 PMC2642995.pdf TACAGGCTTGTCACTCGAATT
6 PMC2642995.pdf CGGAGGCTTGGTTACACATGTT
7 PMC2642995.pdf CTGGCTTTGTCTTTCTTGTTATC
8 PMC2642995.pdf CCCAGCCAGATGCAGTTAACGCCCCACT
9 PMC2642995.pdf TTCACTGTCACACTGGTCACTC
10 PMC2642995.pdf GGTGAAGGTCGGTGTGAACGGA
11 PMC2642995.pdf GTGGGGTCTCGCTCCTGGAAGA
Display recognized sequences in FASTA format