text2genome

About us

Related Links

Press Coverage

PubMed: 17047296    PubMedCentral: PMC1618940

Effects of thalidomide on the expression of adhesion molecules in rat liver cirrhosis.

Lv P, Paul SC, Xiao Y, Liu S, Luo H
Mediators of inflammation, , 2006

Abstract:

This study was to evaluate the effects of thalidomide on expression of adhesion molecules in liver cirrhosis. The cirrhosis was induced in Wistar rats by intraperitoneal injection of CCl(4), and thalidomide (10 mg/kg/day or 100 mg/kg/day) was given by intragastric administration for 8 weeks. Liver histopathology and immunohistochemistry were significantly improved and the expressions of ICAM-1, VCAM-1, E-selectin, and TNF-alpha mRNA and protein were decreased significantly in rats treated with a high dose of thalidomide. Close positive correlation was observed in the expression of the TNF-alpha mRNA and that of ICAM-1, VCAM-1, and E-selectin mRNA, respectively. These results indicate that thalidomide exerts its effect on the downregulation of adhesion molecules via TNF-alpha signaling pathway to inhibit liver fibrosis.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:213/ALB
EntrezGene:24186/ALBU_RAT
EntrezGene:24835/TNFA_RAT
EntrezGene:25464/ICAM1_RAT
EntrezGene:2597/GAPDH
EntrezGene:3383/ICAM1
EntrezGene:3815/KIT
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNFA_RAT ENSRNOG00000000837 1,0
VCAM1_RAT ENSRNOG00000014333 4,5
LYAM2_RAT ENSRNOG00000002723 6,7
G3P_RAT ENSRNOG00000018630 8,9

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
8, 9 chr5:11427597-11427905
8, 9 chr14:43415645-43415952
8, 9 chr5:117080694-117081002
6, 7 chr13:79816280-79818865
8, 9 chr10:25793872-25794180
8, 9 chr5:57052162-57052470
8, 9 chr6:54668002-54668298
8, 9 chr8:44322142-44322450
8, 9 chr5:73006517-73006825
3 chr8:20050317-20050339
8, 9 chr8:105552831-105553138
8, 9 chr7:34078481-34078789
8, 9 chr3:127118364-127118672
8, 9 chr2:19339373-19339680
8, 9 chr10:71195501-71195810
8, 9 chr5:37434397-37434704
4, 5 chr2:212283657-212284942
0, 1 chr20:3662423-3662780
8, 9 chr14:43239406-43239713
8, 9 chr4:161282886-161283306
8, 9 chr1:189772362-189772670
8, 9 chr11:70680156-70680464
8, 9 chr16:25751613-25751921
8, 9 chr13:87367311-87367619

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1618940.pdf GCCAATGGCATGGATCTCAAAG
1 PMC1618940.pdf CAGAGCAATGACTCCAAAGT
2 PMC1618940.pdf CTGCAGAGCACAAACAGCAGAG
3 PMC1618940.pdf AAGGCCGCAGAGCAAAAGAAGC
4 PMC1618940.pdf TAAGTTACACAGCAGTCAAATGGA
5 PMC1618940.pdf CACATACATAAATGCCGGAATCTT
6 PMC1618940.pdf CAACGTGCACGTTTGACTGT
7 PMC1618940.pdf AGGTCAAGGCTTGAACACTG
8 PMC1618940.pdf TCCCTCAAGATTGTCAGCAA
9 PMC1618940.pdf AGATCCACAACGGATACATT
Display recognized sequences in FASTA format