text2genome

About us

Related Links

Press Coverage

PubMed: 9400707    PubMedCentral: PMC1470147

Fiber-specific molecular features of tumors induced in rat peritoneum.

Unfried K, Roller M, Pott F, Friemann J, Dehnen W
Environmental health perspectives, 1103 , 1997

Abstract:

Molecular markers such as mutational spectra or mRNA expression patterns may give some indication of the mechanisms of carcinogenesis induced by fibers and other carcinogens. In our study, tumors were induced by application of crocidolite asbestos or benzo[a]pyrene (B[a]P) to rat peritoneum. DNA and RNA of these tumors were subjected to analysis of point mutations and to investigation of mRNA expression patterns. With both assays we found typical features depending on the type of carcinogen applied. The analysis of point mutations in the tumor suppressor gene p53 revealed mutations in the B[a]P-induced tumors. However, in the tumors induced by crocidolite asbestos that were of the same tumor type as those induced by B[a]P, mutations in p53 were not detectable. Every mutation detected on the DNA level causes an amino acid substitution within one of the functional domains of the tumor suppressor protein. Therefore, these mutations seem to be of biological relevance for tumor progression and indicate a difference in the carcinogenesis regarding the type of the carcinogenic substance. An additional specificity of crocidolite-induced tumors was detectable by analyzing the mRNA expression of the tumor suppressor gene WT1, which is known to be expressed in human mesothelial and mesothelioma cells. A relatively high amount of WT1 mRNA was measured by quantitative competitive reverse transcription-polymerase using RNA extracted from crocidolite-induced tumors. However, WT1 seems to be expressed on a rather low level in tumors induced by B[a]P.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:24842/P53_RAT
EntrezGene:24883/WT1_RAT
EntrezGene:7157/TP53
EntrezGene:7490/WT1

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
P53_RAT ENSRNOG00000010756 2,5
HPRT_RAT ENSRNOG00000031367 8,9

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
1, 2, 5 chr10:56408183-56408890
9 chrX:139961164-139961183
8 chr16:38862535-38862554

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1470147.txt CTTGTCCGCTACTTTGATTCT
1 PMC1470147.txt TGGAAACCAGTTCTAACCCCACA
2 PMC1470147.txt TCCGACTATACCACTATCCAC
3 PMC1470147.txt CCAAGATGCCACAGAGATAAGA
4 PMC1470147.txt GGATGGAGCCCAGCTTCTTTACT
5 PMC1470147.txt AGCTCCGGGCAATGCTCTTCTT
6 PMC1470147.txt ActGGGCCGGACTCGTCATACTC
7 PMC1470147.txt ActTGTGGCATCCACGAAACTAC
8 PMC1470147.txt GCTGGTGAAAAGGACCTCT
9 PMC1470147.txt ACAGGACTAGAACGTCTGC
Display recognized sequences in FASTA format