text2genome

About us

Related Links

Press Coverage

PubMed: 18509505    PubMedCentral: PMC2396792

Identification of CD133-positive radioresistant cells in atypical teratoid/rhabdoid tumor.

Chiou SH, Kao CL, Chen YW, Chien CS, Hung SC, Lo JF, Chen YJ, Ku HH, Hsu MT, Wong TT
PloS one, , 2008

Abstract:

Atypical teratoid/rhabdoid tumor (AT/RT) is an extremely malignant neoplasm in the central nervous system (CNS) which occurs in infancy and childhood. Recent studies suggested that CD133 could be considered a marker for brain cancer stem-like cells (CSCs). However, the role of CD133 in AT/RT has never been investigated. Herein we report the isolation of CD133-positive cells (CD133(+)), found to have the potential to differentiate into three germ layer tissues, from tissues of nine AT/RT patients. The migration/invasion/malignancy and radioresistant capabilities of CD133(+) were significantly augmented when compared to CD133(-). The clinical data showed that the amount of CD133(+) in AT/RTs correlated positively with the degree of resistance to radiation therapy. Using cDNA microarray analysis, the genotoxic-response profiles of CD133(+) and CD133(-) irradiated with 10 Gy ionizing radiation (IR) were analyzed 0.5, 2, 6, 12 and 24 h post-IR. We then validated these microarray data and showed increased phosphorylation after IR of p-ATM, p-RAD17, and p-CHX2 as well as increased expression of BCL-2 protein in CD133(+) compared to CD133(-). Furthermore, we found that CD133(+) can effectively resist IR with cisplatin- and/or TRAIL-induced apoptosis. Immunohistochemical analysis confirmed the up-regulated expression of p-ATM and BCL-2 proteins in IR-treated CD133(+) xenotransgrafts in SCID mice but not in IR-treated CD133(-). Importantly, the effect of IR in CD133(+) transplanted mice can be significantly improved by a combination of BCL-2 siRNA with debromohymenialdisine, an inhibitor of checkpoint kinases. In sum, this is the first report indicating that CD133(+) AT/RT cells demonstrate the characteristics of CSCs. The IR-resistant and anti-apoptotic properties in CD133(+) may reflect the clinical refractory malignancy of AT/RTs and thus the activated p-ATM pathway and BCL-2 expression in CD133(+) could be possible targets to improve future treatment of deadly diseases like AT/RT.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Mus musculus
Molva molva
Homo sapiens
Oryctolagus cuniculus
Meleagris gallopavo
Schizosaccharomyces pombe
Saccharomyces cerevisiae
Bacillus anthracis
Genes found in fulltext (GNAT)
EntrezGene:1026/CDKN1A
EntrezGene:11920/Atm
EntrezGene:12043/Bcl2
EntrezGene:19090/Prkdc
EntrezGene:1950/EGF
EntrezGene:22981/NINL
EntrezGene:472/ATM
EntrezGene:596/BCL2
EntrezGene:598/BCL2L1
EntrezGene:6598/SMARCB1
EntrezGene:7158/TP53BP1
EntrezGene:7431/VIM
EntrezGene:8743/TNFSF10
EntrezGene:8842/PROM1
EntrezGene:92140/MTDH

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
BCL2L1 ENSG00000171552 0,1
MDM2 ENSG00000135679 3,2
CDKN1A ENSG00000124762 5,6
TP53 ENSG00000141510 7,8
TP53BP1 ENSG00000067369 9,10
BCL2 ENSG00000171791 11,12

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
10 chr15:43772061-43772082
11 chr18:60986530-60986549
7, 8 chr17:7577511-7578247
3 chr12:69218364-69218387
5, 6 chr6:36653630-36653794

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2396792.S6.doc CAGGGACAGCATATCAGAG
1 PMC2396792.S6.doc TGGTCATTCAGGTAAGTGG
2 PMC2396792.S6.doc GTAGTAGTCAATCAGCAGGAATC
3 PMC2396792.S6.doc GAAACCAAATGTGAAGATGAAGG
4 PMC2396792.S6.doc CCTGGACACTGAGACTGAG
5 PMC2396792.S6.doc TCTACATCTTCTGCCTTAGTCTC
6 PMC2396792.S6.doc TCTTAGGAACCTCTCATTCAACC
7 PMC2396792.S6.doc TGCGTGTGGAGTATTTGGATG
8 PMC2396792.S6.doc GTGTGATGATGGTGAGGATGG
9 PMC2396792.S6.doc ATACTTCAGGCAATACTACACATTC
10 PMC2396792.S6.doc TTAGCATCCACATCAGACAGC
11 PMC2396792.S6.doc GCGACTCCTGATTCATTGGCCCCCC
12 PMC2396792.S6.doc GTCTACTTCCTCTGTGATGTTG
Display recognized sequences in FASTA format