text2genome

About us

Related Links

Press Coverage

PubMed: 19208906    PubMedCentral: PMC2671051

Loss-of-function mutation in myostatin reduces tumor necrosis factor alpha production and protects liver against obesity-induced insulin resistance.

Wilkes JJ, Lloyd DJ, Gekakis N
Diabetes, 1133 , 2009

Abstract:

OBJECTIVE: Insulin resistance develops in tandem with obesity. Ablating myostatin (Mstn) prevents obesity, so we investigated if Mstn deficiency could improve insulin sensitivity. A loss-of-function mutation (Mstn(Ln)) in either one or both alleles of the Mstn gene shows how Mstn deficiency protects whole-body insulin sensitivity. RESEARCH DESIGN AND METHODS: Mstn(Ln/Ln) mice were weaned onto a high-fat diet (HFD) or standard diet. HFD-fed Mstn(Ln/Ln) mice exhibited high lean, low-fat body compositions compared with wild types. Wild-type and heterozygous and homozygous mutant mice were bled to determine basal levels of insulin, glucose, and homeostasis model assessment of insulin resistance. To evaluate postprandial insulin sensitivity between animals of a similar size, glucose and insulin tolerance tests and hyperinsulinemic-euglycemic clamp studies were performed with heterozygous and homozygous mutant mice. Quantitative RT-PCR quantified TNF proportional, variant, IL-6, IL-1beta, F4/80, GPR43, and CD36 expression in muscle, fat, and liver. Histological analysis measured hepatosteatosis. RESULTS: Homozygous mutants were glucose tolerant and protected against overall insulin resistance compared with heterozygous mice. Hyperinsulinemic-euglycemic clamp studies revealed a dramatically improved glucose infusion rate, glucose disposal rate, and hepatic glucose production in 11-month-old Mstn(Ln/Ln) mice on an HFD. Improvements to muscle and liver insulin sensitivity (approximately 200-400%) correlated with 50-75% decreased tumor necrosis factor (TNF)alpha production and coincided with severe Mstn deficiency. Hepatosteatosis appeared to be ameliorated. Short-term treatment of Mstn(Ln/Ln) mice with recombinant Mstn led to increased plasma TNFalpha and insulin resistance. CONCLUSIONS: We find that severe Mstn deficiency caused by Ln (lean) mutations in HFD-fed mice protects muscle and liver against obesity-induced insulin resistance.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:17700/Mstn

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Rplp0 ENSMUSG00000067274 2,3
Tnf ENSMUSG00000024401 4,5
Il1b ENSMUSG00000027398 6,7,8
Emr1 ENSMUSG00000004730 9,10,11
Il6 ENSMUSG00000025746 12,13,14
Ffar2 ENSMUSG00000051314 15,16,17

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
15, 16, 17 chr7:31603447-31603527
0, 1 chr1:53121048-53121141
10, 11 chr17:57587278-57587341
6, 7 chr2:129190950-129191749
2, 3 chr5:116010810-116010869
8 chr7:87272365-87272542
2, 3 chr2:152179465-152179524
2, 3 chr8:105389524-105389583
8 chr13:79972444-79972627
8 chr12:114068839-114069014
4, 5 chr17:35337290-35337339
12, 13, 14 chr5:30339713-30339956

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2671051.pdf GAATGGCCATGATCTTGCTG
1 PMC2671051.pdf GTAACACGGTTGCTAGAATG
2 PMC2671051.pdf AGATGCAGCAGATCCGCAT
3 PMC2671051.pdf GTTCTTGCCCATCAGCACC
4 PMC2671051.pdf GACTTTCTCCTGGTATGAGATAGCAA
5 PMC2671051.pdf CCTCACCCACACCGTCAGCCG
6 PMC2671051.pdf AATCTATACCTGTCCTGTGTAATGAAAGAC
7 PMC2671051.pdf TGGGTATTGCTTGGGATCCA
8 PMC2671051.pdf ACACCCACCCTGCAGCTGGAGAGT
9 PMC2671051.pdf TTACGATGGAATTCTCCTTGTATATCA
10 PMC2671051.pdf CACAGCAGGAAGGTGGCTATG
11 PMC2671051.pdf CCATGTGGGTACAGTCATCTCCCTGGTATGT
12 PMC2671051.pdf TCAATTCCAGAAACCGCTATGA
13 PMC2671051.pdf CACCAGCATCAGTCCCAAGA
14 PMC2671051.pdf CTCTCTGCAAGAGACTTCCATCCAGT
15 PMC2671051.pdf GGGATCTGGGTCACATGCTTAT
16 PMC2671051.pdf ATGTCAGACAGACGGGTACCAA
17 PMC2671051.pdf TCTGTGTCACCAGTCACTGGGTCTAGGAGAT
Display recognized sequences in FASTA format