text2genome

About us

Related Links

Press Coverage

PubMed: 19234609    PubMedCentral: PMC2642998

Integrative analysis of epigenetic modulation in melanoma cell response to decitabine: clinical implications.

Halaban R, Krauthammer M, Pelizzola M, Cheng E, Kovacs D, Sznol M, Ariyan S, Narayan D, Bacchiocchi A, Molinaro A, Kluger Y, Deng M, Tran N, Zhang W, Picardo M, Enghild JJ
PloS one, , 2009

Abstract:

Decitabine, an epigenetic modifier that reactivates genes otherwise suppressed by DNA promoter methylation, is effective for some, but not all cancer patients, especially those with solid tumors. It is commonly recognized that to overcome resistance and improve outcome, treatment should be guided by tumor biology, which includes genotype, epigenotype, and gene expression profile. We therefore took an integrative approach to better understand melanoma cell response to clinically relevant dose of decitabine and identify complementary targets for combined therapy. We employed eight different melanoma cell strains, determined their growth, apoptotic and DNA damage responses to increasing doses of decitabine, and chose a low, clinically relevant drug dose to perform whole-genome differential gene expression, bioinformatic analysis, and protein validation studies. The data ruled out the DNA damage response, demonstrated the involvement of p21(Cip1) in a p53-independent manner, identified the TGFbeta pathway genes CLU and TGFBI as markers of sensitivity to decitabine and revealed an effect on histone modification as part of decitabine-induced gene expression. Mutation analysis and knockdown by siRNA implicated activated beta-catenin/MITF, but not BRAF, NRAS or PTEN mutations as a source for resistance. The importance of protein stability predicted from the results was validated by the synergistic effect of Bortezomib, a proteasome inhibitor, in enhancing the growth arrest of decitabine in otherwise resistant melanoma cells. Our integrative analysis show that improved therapy can be achieved by comprehensive analysis of cancer cells, identified biomarkers for patient's selection and monitoring response, as well as targets for improved combination therapy.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1026/CDKN1A
EntrezGene:10273/STUB1
EntrezGene:1029/CDKN2A
EntrezGene:11186/RASSF1
EntrezGene:1191/CLU
EntrezGene:12578/Cdkn2a
EntrezGene:1278/COL1A2
EntrezGene:1499/CTNNB1
EntrezGene:1647/GADD45A
EntrezGene:1786/DNMT1
EntrezGene:18176/Nras
EntrezGene:2146/EZH2
EntrezGene:2335/FN1
EntrezGene:27241/BBS9
EntrezGene:3065/HDAC1
EntrezGene:3320/HSP90AA2
EntrezGene:347735/SERINC2
EntrezGene:3487/IGFBP4
EntrezGene:3488/IGFBP5
EntrezGene:3815/KIT
EntrezGene:3875/KRT18P19
EntrezGene:4218/RAB8A
EntrezGene:4286/MITF
EntrezGene:4312/MMP1
EntrezGene:472/ATM
EntrezGene:5728/PTEN
EntrezGene:5777/PTPN6
EntrezGene:581/BAX
EntrezGene:5915/RARB
EntrezGene:60/ACTB
EntrezGene:6275/S100A4
EntrezGene:673/BRAF
EntrezGene:6839/SUV39H1
EntrezGene:7045/TGFBI
EntrezGene:7157/TP53
EntrezGene:7161/TP73
EntrezGene:7345/UCHL1
EntrezGene:8153/RND2
EntrezGene:8793/TNFRSF10D
EntrezGene:8996/NOL3
EntrezGene:9734/HDAC9

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
CLU ENSG00000120885 0,25
TGFBI ENSG00000120708 1,27,28
CTNNB1 ENSG00000168036 2,24,3,4,23
TP53 ENSG00000141510 14,11,12,13
PTEN ENSG00000171862 19,20,21,22

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
19, 20, 21, 22 chr9:33675262-33676693
15, 16 chr7:140453014-140453224
1, 27, 28 chr5:135388722-135389736
26 chr6:36653555-36653578
0, 25 chr8:27457296-27463934
11, 12, 13, 14 chr17:7572812-7590715
17, 18 chr1:115256460-115256610
2, 3, 23, 24 chr3:41240947-41277293
10 chr15:57441655-57442111

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2642998.pdf ACAGACCTGCATGAAGTTCTA
1 PMC2642998.pdf CGGGAAGGCGATCATCTCCAA
2 PMC2642998.pdf CTCGGGATGTTCACAACCGAA
3 PMC2642998.pdf CAGCGGCTTCTGCGCGACTTA
4 PMC2642998.pdf CAGGATGATCCTAGCTATCGT
5 PMC2642998.S6.doc AGGAGGGAAGTGTTTTTTTGTAGTA
6 PMC2642998.S6.doc ACAACTACTCACACCTCAACTAAC
7 PMC2642998.S6.doc GGGTGGGTGTTTAGGGTAGTTA
8 PMC2642998.S6.doc AACCTACTATACTACAACACCAAC
9 PMC2642998.S6.doc GTTAGTAGGGTTAGGGAATTGTGAG
10 PMC2642998.S6.doc ACACACCCCCTTTAAAACTAACTAC
11 PMC2642998.S6.doc TGACACGCTTCCCTGGATTG
12 PMC2642998.S6.doc GCACAAACACGCACCTCAAAG
13 PMC2642998.S6.doc TGGTAATCTACTGGGACGGAACAG
14 PMC2642998.S6.doc GCTTCTGACGCACACCTATTGC
15 PMC2642998.S6.doc CTACTGTTTTCCTTTACTTACTACACCTCAGA
16 PMC2642998.S6.doc AACTCAGCAGCATCTCAGGGC
17 PMC2642998.S6.doc CACACCCCCAGGATTCTTAC
18 PMC2642998.S6.doc TGGCAAATACACAGAGGAAGC
19 PMC2642998.S6.doc TGCCATCTCTCTCCTCCTTTTTC
20 PMC2642998.S6.doc CCTCTGGTCCTGGTATGAAGAAT
21 PMC2642998.S6.doc GAGTAACTATTCCCAGTCAGAGGCG
22 PMC2642998.S6.doc CAAGTGTCAAAACCCTGTGGATG
23 PMC2642998.S6.doc TGGAACCAGACAGAAAAGCGG
24 PMC2642998.S6.doc TGAGTGAAGGACTGAGAAAATCCC
25 PMC2642998.S6.doc CGTGGTGACCCGCAGATAGT
26 PMC2642998.S6.doc ATTAGGGCTTCCTCTTGGAGAAG
27 PMC2642998.S6.doc TCCACAGCCATTGACCTTTTC
28 PMC2642998.S6.doc TCAACCGCTCACTTCCAGAGA
Display recognized sequences in FASTA format