text2genome

About us

Related Links

Press Coverage

PubMed: 2829119    PubMedCentral: PMC334628

DNA containing the base analogue 2-aminoadenine: preparation, use as hybridization probes and cleavage by restriction endonucleases.

Chollet A, Kawashima E
Nucleic acids research, 305 , 1988

Abstract:

The base analogue 2-aminoadenine (2,6-diaminopurine, D) has been introduced at selected positions into synthetic oligodeoxyribonucleotides and DNA by the combined use of chemical and enzymatic methods. 2-aminoadenine substitution for adenine introduces changes in the minor groove of DNA and creates an additional hydrogen bond in the Watson-Crick base pair with thymine. Oligonucleotide hybridization probes containing 2-aminoadenine showed increased selectivity and hybridization strength during DNA-DNA hybridization to phage or genomic target DNA. Properties of the base analogue with respect to DNA modifying enzymes were examined. 2-aminoadenine was used to probe minor groove determinants during the treatment of DNA by 12 restriction endonucleases. Inhibition of cleavage was found for several restriction enzymes.

Organism/Genes in external databases

Datasource Data

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNF ENSG00000206439 5,6,7
TNF ENSG00000223952 5,6,7
TNF ENSG00000228321 5,6,7
TNF ENSG00000228849 5,6,7
TNF ENSG00000230108 5,6,7
TNF ENSG00000232810 5,6,7
TNF ENSG00000204490 7,5,6

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
5, 6, 7 HSCHR6_MHC_COX:31530993-31532719
5, 6, 7 HSCHR6_MHC_QBL:31533822-31535550
5, 6, 7 HSCHR6_MHC_MCF:31619890-31621616
5, 6, 7 HSCHR6_MHC_SSTO:31533524-31535250
5, 6, 7 HSCHR6_MHC_DBB:31525725-31527451
5, 6, 7 chr6:31543581-31545307
5, 6, 7 HSCHR6_MHC_MANN:31583068-31584794

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC334628.txt TGACCGGCAGCAAAATGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCGTTTTAC
1 PMC334628.txt ACCACTGGCGGTGATACTG
2 PMC334628.txt CCCTTGCTCGTGTGTCGTCCTG
3 PMC334628.txt CCACTATGACTCGTGTAGTCGTCCTAG
4 PMC334628.txt CTGAAACCGGCGAAGGACTTTGGCCGCTTC
5 PMC334628.txt GCAATGATCCCAAAGTAGAC
6 PMC334628.txt ACGATCAGGAAGGAGAAGAG
7 PMC334628.txt CTGGAGCCCTGGGGCCCCCC
8 PMC334628.txt TTCGTTCGGCTCGGTCCCGGGGTCCTCTGGTCGCCTGCGGCTGCGCTTGGTGCTTGCTCGGCCTGGGCCCCTGGGTCTCGCTGGCGTCCGTCGTTCGCC
9 PMC334628.txt GCCTGCGGCTGCGCTTGGTTCGTTCGGCTCGGTCCCGGGGTCCTCTGGTGGTCTCGCTGGCGTCCGTCGTTCGCCTGCTTGCTCGGCCTGGGCCCCTG
10 PMC334628.txt GTCGACAGCTGGATCCGAATTCAAGCTT
11 PMC334628.txt GGTACCCTGCAGGTACGATCTCTAGA
Display recognized sequences in FASTA format