text2genome

About us

Related Links

Press Coverage

PubMed: 20089165    PubMedCentral: PMC2817659

Long acting beta2-agonist and corticosteroid restore airway glandular cell function altered by bacterial supernatant.

Zahm JM, Delavoie F, Toumi F, Nawrocki-Raby B, Kileztky C, Michel J, Balossier G, Johnson M, Coraux C, Birembaut P
Respiratory research, 6 , 2010

Abstract:

BACKGROUND: Staphylococcus aureus releases virulence factors (VF) that may impair the innate protective functions of airway cells. The aim of this study was to determine whether a long-acting beta2 adrenergic receptor agonist (salmeterol hydroxynaphthoate, Sal) combined with a corticosteroid (fluticasone propionate, FP) was able to regulate ion content and cytokine expression by airway glandular cells after exposure to S. aureus supernatant. METHODS: A human airway glandular cell line was incubated with S. aureus supernatant for 1 h and then treated with the combination Sal/FP for 4 h. The expression of actin and CFTR proteins was analyzed by immunofluorescence. Videomicroscopy was used to evaluate chloride secretion and X-ray microanalysis to measure the intracellular ion and water content. The pro-inflammatory cytokine expression was assessed by RT-PCR and ELISA. RESULTS: When the cells were incubated with S. aureus supernatant and then with Sal/FP, the cellular localisation of CFTR was apical compared to the cytoplasmic localisation in cells incubated with S. aureus supernatant alone. The incubation of airway epithelial cells with S. aureus supernatant reduced by 66% the chloride efflux that was fully restored by Sal/FP treatment. We also observed that Sal/FP treatment induced the restoration of ion (Cl and S) and water content within the intracellular secretory granules of airway glandular cells and reduced the bacterial supernatant-dependent increase of pro-inflammatory cytokines IL8 and TNFalpha. CONCLUSIONS: Our results demonstrate that treatment with the combination of a corticosteroid and a long-acting beta2 adrenergic receptor agonist after bacterial infection restores the airway glandular cell function. Abnormal mucus induced by defective ion transport during pulmonary infection could benefit from treatment with a combination of beta2 adrenergic receptor agonist and glucocorticoid.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Staphylococcus aureus
Homo sapiens
Mus musculus
Oryctolagus cuniculus
Armoracia rusticana
Capra hircus
Pseudomonas aeruginosa
Rattus norvegicus

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
IL8 ENSG00000169429 0,1
TNF ENSG00000204490 2,3
TNF ENSG00000206439 2,3
TNF ENSG00000223952 2,3
TNF ENSG00000228321 2,3
TNF ENSG00000228849 2,3
TNF ENSG00000230108 2,3
TNF ENSG00000232810 2,3

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3 HSCHR6_MHC_SSTO:31533559-31534955
2, 3 HSCHR6_MHC_DBB:31525760-31527156
2, 3 HSCHR6_MHC_COX:31531028-31532424
0 chr4:74607268-74607292
2, 3 HSCHR6_MHC_QBL:31533857-31535255
2, 3 HSCHR6_MHC_MCF:31619925-31621321
2, 3 HSCHR6_MHC_MANN:31583103-31584499
2, 3 chr6:31543616-31545012

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2817659.pdf GCCAAGGAGTGCTAAAGAACTTAG
1 PMC2817659.pdf GAATTCTCAGCCCTCTTCAAAAAC
2 PMC2817659.pdf CAGCCTCTTCTCCTTCCTGA
3 PMC2817659.pdf TGAGGTACAGGCCCTCTGAT
4 PMC2817659.pdf GTTCACCCACTAATAGGGAACGTGA
5 PMC2817659.pdf GGATTCTGACTTAGAGGCGTTCAGT
Display recognized sequences in FASTA format