text2genome

About us

Related Links

Press Coverage

PubMed: 20111595    PubMedCentral: PMC2810325

Increased susceptibility to dextran sulfate sodium induced colitis in the T cell protein tyrosine phosphatase heterozygous mouse.

Hassan SW, Doody KM, Hardy S, Uetani N, Cournoyer D, Tremblay ML
PloS one, , 2010

Abstract:

T cell protein tyrosine phosphatase (TC-PTP/PTPN2) is an enzyme that is essential for the proper functioning of the immune system and that participates in the control of cell proliferation, and inflammation. We previously observed that TC-PTP(-/-) mice display various immunodeficiencies, hypersensitivity to LPS and die within three weeks of birth due to anemia and widespread inflammation. A recent analysis of the Wellcome Trust Case Control Consortium (WTCC) genome wide scan data, reported in 2007, indicated a potential role for TC-PTP in inflammatory bowel disease (IBD). To further investigate the potential role of TC-PTP in IBD, we studied heterozygous TC-PTP mutant mice challenged with dextran sulfate sodium (DSS) in their drinking water. In comparison to control animals, we observed significant changes in the colon mucosa of DSS-treated TC-PTP(+/-) mice, in the ratio of colon to body weight, as well as an up-regulation of mRNA transcripts for IL-6, IL-23, 1L-12beta, IFN-gamma, TNF-alpha. Moreover, up-regulation of serum IL-6 levels in DSS-treated TC-PTP(+/-) mice confirms that mice with a single copy of the TC-PTP gene display increased susceptibility to systemic inflammation due to bowel epithelial erosion resulting from DSS challenge. Our findings support the lack of modulation of Janus kinases 1 and 3 (Jak1, Jak3), and the downstream signal transducer and activator of transcription 1,3 and 5 (Stat1, Stat3, Stat 5) by PTPN2 in the development of IBD like condition. Pathological and molecular analysis reveal that the deficiency of TC-PTP results in pro-inflammatory condition in the bowel of heterozygous TC-PTP(+/-) mice. These novel findings in TC-PTP hemi-deficiency support the hypothesis that TC-PTP is an important regulator of inflammatory cytokine signaling and that it may be implicated in the pathophysiology of IBD.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:19255/Ptpn2

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Lrrc58 ENSMUSG00000034158 0,1
Il6 ENSMUSG00000025746 2,3
Tnf ENSMUSG00000024401 4,5
Ifng ENSMUSG00000055170 6,7
Il12b ENSMUSG00000004296 8,9
Il23r ENSMUSG00000049093 11,10

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
5 chr17:35337153-35337173
2, 3 chr5:30339925-30340065
10, 11 chr6:67384652-67423899
8, 9 chr11:44221385-44222022
7 chr10:117882278-117882298
0, 1 chr17:8758093-8758281
0, 1 chr5:143664855-143665043

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2810325.pdf AGGTGACAGCATTGCTTCTG
1 PMC2810325.pdf GCTGCCTCAACACCTCAAC
2 PMC2810325.pdf TCCAGTTGCCTTCTTGGGAC
3 PMC2810325.pdf GTGTAATTAAGCCTCCGACTTG
4 PMC2810325.pdf CCTGTAGCCCACGTCGTAGC
5 PMC2810325.pdf TTGACCTCAGCGCTGAGTTG
6 PMC2810325.pdf TGGAGGAACTGGCAAAAGGATG
7 PMC2810325.pdf CGCTTCCTGAGGCTGGATTC
8 PMC2810325.pdf AGATGACATCACCTGGACCTCAG
9 PMC2810325.pdf ACGTGAACCGTCCGGAGTAA
10 PMC2810325.pdf TCCACTGACTCACTGCAAGG
11 PMC2810325.pdf GTTCGTGGGATGATTTTGCT
Display recognized sequences in FASTA format