text2genome

About us

Related Links

Press Coverage

PubMed: 20444277    PubMedCentral: PMC2881047

Effects of phosphodiesterase 4 inhibition on bleomycin-induced pulmonary fibrosis in mice.

Udalov S, Dumitrascu R, Pullamsetti SS, Al-tamari HM, Weissmann N, Ghofrani HA, Guenther A, Voswinckel R, Seeger W, Grimminger F, Schermuly RT
BMC pulmonary medicine, 26 , 2010

Abstract:

BACKGROUND: Pulmonary fibrosis (PF) is a group of devastating and largely irreversible diseases. Phosphodiesterase (PDE) 4 is involved in the processes of remodeling and inflammation, which play key role in tissue fibrosis. The aim of the study was, therefore, to investigate the effect of PDE4 inhibition in experimental model of PF. METHODS: PF was induced in C57BL/6N mice by instillation of bleomycin. Pharmacological inhibition of PDE4 was achieved by using cilomilast, a selective PDE4 inhibitor. Changes in either lung inflammation or remodeling were evaluated at different stages of experimental PF. Lung inflammation was assessed by bronchoalveolar lavage fluid (BALF) differential cell count and reverse transcription quantitative polymerase chain reaction (RT-qPCR) for inflammatory cytokines. Changes in tissue remodeling were evaluated by pulmonary compliance measurement, quantified pathological examination, measurement of collagen deposition and RT-qPCR for late remodeling markers. Survival in all groups was analyzed as well. RESULTS: PDE4 inhibition significantly reduced the total number of alveolar inflammatory cells in BALF of mice with bleomycin-induced PF at early fibrosis stage (days 4 and 7). Number of macrophages and lymphocytes, but not neutrophils, was significantly reduced as well. Treatment decreased lung tumor necrosis factor (TNF)-alpha mRNA level and increased mRNA level of interleukin (IL)-6 but did not influence IL-1 beta. At later stage (days 14 and 24) cilomilast improved lung function, which was shown by increase in lung compliance. It also lowered fibrosis degree, as was shown by quantified pathological examination of Hematoxilin-Eosin stained lung sections. Cilomilast had no significant effect on the expression of late remodeling markers such as transforming growth factor (TGF)-beta1 and collagen type Ia1 (COL(I)alpha1). However, it tended to restore the level of lung collagen, assessed by SIRCOL assay and Masson's trichrome staining, and to improve the overall survival. CONCLUSIONS: Selective PDE4 inhibition suppresses early inflammatory stage and attenuates the late stage of experimental pulmonary fibrosis.

Organism/Genes in external databases

Datasource Data

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Actb ENSMUSG00000029580 0,1
Tnf ENSMUSG00000024401 2,3
Il1b ENSMUSG00000027398 4,5
Il6 ENSMUSG00000025746 6,7
Col1a1 ENSMUSG00000001506 8,9
Tgfb1 ENSMUSG00000002603 10,11

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
10, 11 chr7:26477476-26479357
6, 7 chr5:30339713-30339956
0, 1 chr5:143665835-143666166
2 chr17:35338675-35338697
4, 5 chr2:129192985-129193724
8, 9 chr11:94797688-94799328

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2881047.pdf CTCTAGACTTCGAGCAGGAGATG
1 PMC2881047.pdf CACTGTGTTGGCATAGAGGTCTT
2 PMC2881047.pdf GCCTATGTCTCAGCCTCTTCTC
3 PMC2881047.pdf CACTTGGTGGTTTGCTACGA
4 PMC2881047.pdf GAGCACCTTCTTTTCCTTCATCT
5 PMC2881047.pdf GATATTCTGTCCATTGAGGTGGA
6 PMC2881047.pdf TCAATTCCAGAAACCGCTATGAA
7 PMC2881047.pdf CACCAGCATCAGTCCCAAGAA
8 PMC2881047.pdf AGCTTTGTGGACCTCCGGCT
9 PMC2881047.pdf ACACAGCCGTGCCATTGTGG
10 PMC2881047.pdf AACCCCCATTGCTGTCCCGT
11 PMC2881047.pdf CCTTGGTTCAGCCACTGCCG
Display recognized sequences in FASTA format