text2genome

About us

Related Links

Press Coverage

PubMed: 19652016    PubMedCentral: PMC2737162

Disordered macrophage cytokine secretion underlies impaired acute inflammation and bacterial clearance in Crohn's disease.

Smith AM, Rahman FZ, Hayee B, Graham SJ, Marks DJ, Sewell GW, Palmer CD, Wilde J, Foxwell BM, Gloger IS, Sweeting T, Marsh M, Walker AP, Bloom SL, Segal AW
The Journal of experimental medicine, 1883 , 2009

Abstract:

The cause of Crohn's disease (CD) remains poorly understood. Counterintuitively, these patients possess an impaired acute inflammatory response, which could result in delayed clearance of bacteria penetrating the lining of the bowel and predispose to granuloma formation and chronicity. We tested this hypothesis in human subjects by monitoring responses to killed Escherichia coli injected subcutaneously into the forearm. Accumulation of (111)In-labeled neutrophils at these sites and clearance of (32)P-labeled bacteria from them were markedly impaired in CD. Locally increased blood flow and bacterial clearance were dependent on the numbers of bacteria injected. Secretion of proinflammatory cytokines by CD macrophages was grossly impaired in response to E. coli or specific Toll-like receptor agonists. Despite normal levels and stability of cytokine messenger RNA, intracellular levels of tumor necrosis factor (TNF) were abnormally low in CD macrophages. Coupled with reduced secretion, these findings indicate accelerated intracellular breakdown. Differential transcription profiles identified disease-specific genes, notably including those encoding proteins involved in vesicle trafficking. Intracellular destruction of TNF was decreased by inhibitors of lysosomal function. Together, our findings suggest that in CD macrophages, an abnormal proportion of cytokines are routed to lysosomes and degraded rather than being released through the normal secretory pathway.

Organism/Genes in external databases

Datasource Data

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
CSF2 ENSG00000164400 0,1
IL6 ENSG00000136244 2,3,4
IFNG ENSG00000111537 7,5,6
TNF ENSG00000204490 8,9,10
TNF ENSG00000206439 8,9,10
TNF ENSG00000223952 8,9,10
TNF ENSG00000228321 8,9,10
TNF ENSG00000228849 8,9,10
TNF ENSG00000230108 8,9,10
TNF ENSG00000232810 8,9,10

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
8, 9, 10 HSCHR6_MHC_APD:31556438-31556555
8, 9, 10 HSCHR6_MHC_COX:31532529-31532646
5, 6, 7 chr12:68549150-68549250
2, 4 chr7:22771053-22771099
8, 9, 10 chr6:31545117-31545234
8, 9, 10 HSCHR6_MHC_DBB:31527261-31527378
8, 9, 10 HSCHR6_MHC_MANN:31584604-31584721
8, 9, 10 HSCHR6_MHC_QBL:31535360-31535477
8, 9, 10 HSCHR6_MHC_MCF:31621426-31621543
0, 1 chr5:131410556-131410599
8, 9, 10 HSCHR6_MHC_SSTO:31535060-31535177

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2737162.pdf AGCCTCACCAAGCTCAAGGG
1 PMC2737162.pdf CCCTTGACCATGATGGCCAGCC
2 PMC2737162.pdf TGACCCAACCACAAATGCCA
3 PMC2737162.pdf CATGTCCTGCAGCCACTGG
4 PMC2737162.pdf CTGTGCCTGCAGCTTCGTCAGCA
5 PMC2737162.pdf CCAACGCAAAGCAATACATGAAC
6 PMC2737162.pdf ACCTCGAAACAGCATCTGACTCC
7 PMC2737162.pdf TCATCCAAGTGATGGCTGAACTGTCGC
8 PMC2737162.pdf TCCTCTCTGCCATCAAGAGCC
9 PMC2737162.pdf GTCGGTCACCCTTCTCCAGC
10 PMC2737162.pdf TGGAAGACCCCTCCCAGATAGAT
Display recognized sequences in FASTA format