text2genome

About us

Related Links

Press Coverage

PubMed: 18426983    PubMedCentral: PMC2373835

IL-6-dependent spontaneous proliferation is required for the induction of colitogenic IL-17-producing CD8+ T cells.

Tajima M, Wakita D, Noguchi D, Chamoto K, Yue Z, Fugo K, Ishigame H, Iwakura Y, Kitamura H, Nishimura T
The Journal of experimental medicine, 1019 , 2008

Abstract:

We propose a novel role for interleukin (IL) 6 in inducing rapid spontaneous proliferation (SP) of naive CD8(+) T cells, which is a crucial step in the differentiation of colitogenic CD8(+) T cells. Homeostasis of T cells is regulated by two distinct modes of cell proliferation: major histocompatibility complex/antigen-driven rapid SP and IL-7/IL-15-dependent slow homeostatic proliferation. Using our novel model of CD8(+) T cell-dependent colitis, we found that SP of naive CD8(+) T cells is essential for inducing pathogenic cytokine-producing effector T cells. The rapid SP was predominantly induced in mesenteric lymph nodes (LNs) but not in peripheral LNs under the influence of intestinal flora and IL-6. Indeed, this SP was markedly inhibited by treatment with anti-IL-6 receptor monoclonal antibody (IL-6R mAb) or antibiotic-induced flora depletion, but not by anti-IL-7R mAb and/or in IL-15-deficient conditions. Concomitantly with the inhibition of SP, anti-IL-6R mAb significantly inhibited the induction of CD8(+) T cell-dependent autoimmune colitis. Notably, the transfer of naive CD8(+) T cells derived from IL-17(-/-) mice did not induce autoimmune colitis. Thus, we conclude that IL-6 signaling is crucial for SP under lymphopenic conditions, which subsequently caused severe IL-17-producing CD8(+) T cell-mediated autoimmune colitis. We suggest that anti-IL-6R mAb may become a promising strategy for the therapy of colitis.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:16168/Il15
EntrezGene:16171/Il17a
EntrezGene:16193/Il6
Genes found in fulltext (GNAT)
EntrezGene:16171/Il17a
EntrezGene:16193/Il6
EntrezGene:16409/Itgam
EntrezGene:19374/Rag2
EntrezGene:21926/Tnf

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Il7 ENSMUSG00000040329 0,1,2
Il15 ENSMUSG00000031712 3,4,5
Il6 ENSMUSG00000025746 6,7,8
Tgfb1 ENSMUSG00000002603 9,10,11
Tnf ENSMUSG00000024401 15,16,17
Ifng ENSMUSG00000055170 18,19,20
Il17a ENSMUSG00000025929 23,22
Actb ENSMUSG00000029580 24,25,26

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
24, 25, 26 chr5:143666354-143666435
9, 10, 11 chr7:26479318-26482194
21, 22, 23 chr1:20722333-20723787
0, 1, 2 chr3:7613189-7613264
12 chr2:129191707-129191726
18, 19 chr10:117879820-117882297
6, 7 chr5:30340004-30341416
15, 16, 17 chr17:35337297-35337377
3, 5 chr8:84903459-84903511
13 chr10:52149910-52150051

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2373835.pdf GAGGTGGGTGTAGTCATGATGACT
1 PMC2373835.pdf GGGTCCTGGGAGTGATTATGG
2 PMC2373835.pdf AGCCGGCTCCTGCTGCAGTCC
3 PMC2373835.pdf GACCATGAAGAGGCAGTGCTT
4 PMC2373835.pdf CAGCTCAGAGAGGTCAGGAAAGA
5 PMC2373835.pdf CCACCTTGACACATGGCCCTCTGG
6 PMC2373835.pdf GAGGATACCACTCCCAACAGACC
7 PMC2373835.pdf AAGTGCATCATCGTTGTTCATACA
8 PMC2373835.pdf CAGAATTGCCATTGCACAACTCTTTTCTCA
9 PMC2373835.pdf TGACGTCACTGGAGTTGTACGG
10 PMC2373835.pdf GGTTCATGTCATGGATGGTGC
11 PMC2373835.pdf TTCAGCGCTCACTGCTCTTGTGACAG
12 PMC2373835.pdf GAAAGACGGCACACCCACC
13 PMC2373835.pdf AGACAAACCGCTTTTCCATCTTC
14 PMC2373835.pdf TGCAGCTGGAGAGTGTGGATCCCAA
15 PMC2373835.pdf GTTCTCTTCAAGGGACAAGGCTG
16 PMC2373835.pdf TCCTGGTATGAGATAGCAAATCGG
17 PMC2373835.pdf TACGTGCTCCTCACCCACACCGTCA
18 PMC2373835.pdf GGATGCATTCATGAGTATTGC
19 PMC2373835.pdf GCTTCCTGAGGCTGGATTC
20 PMC2373835.pdf TTTGAGGTCAACAACCCACAGGTCCA
21 PMC2373835.pdf GCTCCAGAAGGCCCTCAGA
22 PMC2373835.pdf CTTTCCCTCCGCATTGACA
23 PMC2373835.pdf ACCTCAACCGTTCCACGTCAC
24 PMC2373835.pdf AGCCATGTACGTAGCCATCCA
25 PMC2373835.pdf TCTCCGGAGTCCATCACAATG
26 PMC2373835.pdf TGTCCCTGTATGCCTCTGGTCGTACCA
Display recognized sequences in FASTA format