text2genome

About us

Related Links

Press Coverage

PubMed: 19371233    PubMedCentral: PMC2708930

Group III secreted phospholipase A2 transgenic mice spontaneously develop inflammation.

Sato H, Taketomi Y, Isogai Y, Masuda S, Kobayashi T, Yamamoto K, Murakami M
The Biochemical journal, 17 , 2009

Abstract:

PLA2 (phospholipase A2) group III is an atypical sPLA2 (secretory PLA2) that is homologous with bee venom PLA2 rather than with other mammalian sPLA2s. In the present paper, we show that endogenous group III sPLA2 (PLA2G3) is expressed in mouse skin and that Tg (transgenic) mice overexpressing human PLA2G3 spontaneously develop skin inflammation. Pla2g3-Tg mice over 9 months of age frequently developed dermatitis with hyperkeratosis, acanthosis, parakeratosis, erosion, ulcer and sebaceous gland hyperplasia. The dermatitis was accompanied by infiltration of neutrophils and macrophages and by elevated levels of pro-inflammatory cytokines, chemokines and prostaglandin E2. In addition, Pla2g3-Tg mice had increased lymph aggregates and mucus in the airway, lymphocytic sialadenitis, hepatic extramedullary haemopoiesis, splenomegaly with increased populations of granulocytes and monocytes/macrophages, and increased serum IgG1. Collectively, these observations provide the first demonstration of spontaneous development of inflammation in mice with Tg overexpression of mammalian sPLA2.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:50487/PLA2G3
EntrezGene:237625/Pla2g3
Genes found in fulltext (GNAT)
EntrezGene:12514/Cd68
EntrezGene:12902/Cr2
EntrezGene:14433/380687-208
EntrezGene:16189/Il4
EntrezGene:16193/Il6
EntrezGene:16411/Itgax
EntrezGene:17523/Mpo
EntrezGene:18780/Pla2g2a
EntrezGene:18782/Pla2g2d
EntrezGene:18784/Pla2g5
EntrezGene:20296/Ccl2
EntrezGene:237625/Pla2g3
EntrezGene:2597/GAPDH
EntrezGene:26279/PLA2G2D
EntrezGene:26565/Pla2g10
EntrezGene:26970/Pla2g2e
EntrezGene:26971/Pla2g2f
EntrezGene:30814/PLA2G2E
EntrezGene:3290/HSD11B1
EntrezGene:341/APOC1
EntrezGene:3565/IL4
EntrezGene:3569/IL6
EntrezGene:4353/MPO
EntrezGene:50487/PLA2G3
EntrezGene:5320/PLA2G2A
EntrezGene:5322/PLA2G5
EntrezGene:57266/Cxcl14
EntrezGene:6347/CCL2
EntrezGene:64292/Ptges
EntrezGene:64600/PLA2G2F
EntrezGene:9547/CXCL14
EntrezGene:968/CD68
EntrezGene:96979/Ptges2

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Cma1 ENSMUSG00000022225 1,2
Tpsb2 ENSMUSG00000033825 3,4
Gapdh ENSMUSG00000057666 5,6
Tnf ENSMUSG00000024401 7,8
Il1b ENSMUSG00000027398 9,10
Il6 ENSMUSG00000025746 11,12
Il4 ENSMUSG00000000869 13,14
Ifng ENSMUSG00000055170 15,16
Ccl2 ENSMUSG00000035385 19,20
Cxcl14 ENSMUSG00000021508 21,22
Pla2g3 ENSMUSG00000034579 25,26
Pla2g5 ENSMUSG00000041193 27,28
Pla2g10 ENSMUSG00000022683 29,30
Pla2g2d ENSMUSG00000041202 31,32
Pla2g2e ENSMUSG00000028751 33,34
Pla2g2f ENSMUSG00000028749 35,36
Hdc ENSMUSG00000027360 37,38

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
5, 6 chr15:12505361-12505612
5, 6 NT_166349:397139-397390
19, 20 chr11:81849177-81850651
11, 12 chr5:30340002-30346010
5, 6 chr3:52417474-52417725
1, 2 chr14:56560514-56608498
5, 6 chrX:77439222-77439473
5, 6 chr3:142626292-142626543
5, 6 chr17:61920370-61920621
5, 6 chr14:12113478-12113729
37, 38 chr2:126420087-126423675
5, 6 chr5:28865827-28866078
5, 6 chr17:14846778-14847029
5, 6 chr6:83824405-83824656
5, 6 chr6:125112082-125112527
5, 6 chr6:84762957-84763208
9, 10 chr2:129190863-129193896
30 chr16:13715636-13715660
25 chr11:3390878-3390902
13 chr11:53432069-53432093
5, 6 chr3:139313060-139313311
5, 6 chr8:77929449-77929700
5, 6 chr4:82840614-82840865
33, 34 chr4:138435376-138438456
5, 6 chr2:28789160-28789411
27, 28, 32, 35, 36 chr4:138308239-138362133
5, 6 chr4:91518391-91518642
5, 6 chr3:121933145-121933396
15 chr10:117878216-117878240
7, 8 chr17:35337177-35338776
5, 6 chr5:13042465-13042716
5, 6 chr8:60029816-60030067
5, 6 chr15:4835837-4836088
5, 6 chr4:57383857-57384108
5, 6 chr7:59002784-59003035
5, 6 chr5:96291450-96291701
5, 6 chr11:26687350-26687601
5, 6 chr1:15258912-15259163
5, 6 chr2:11330689-11330940
21 chr13:56397247-56397269
3, 4 chr17:25503990-25504896
5, 6 chr10:13610484-13610735
0 chr14:56679428-56679449
5, 6 chr8:95239858-95240109
5, 6 chr5:106291752-106292003
5, 6 chr11:20235047-20235298

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2708930.pdf TCTCAGTTTCACCTCCCTCAG
1 PMC2708930.pdf ATAACAGTCCTCCTAGGAGCC
2 PMC2708930.pdf GATCCAGGGCCTGTAATGGGA
3 PMC2708930.pdf GCACATCAAAAGCCCACAGC
4 PMC2708930.pdf TAGACAGGGGAGACAGAGGAC
5 PMC2708930.pdf TCGTGGATCTGACGTGCCGCCTG
6 PMC2708930.pdf CACCACCCTGTTGCTGTAGCCGTAT
7 PMC2708930.pdf GAAAGCATGATCCGCGACGTGGAA
8 PMC2708930.pdf CCCTTCTCCAGCTGGAAGACTCCT
9 PMC2708930.pdf AGGGCTGCTTCCAAACCTTTGACC
10 PMC2708930.pdf CCAGTTGGGGAACTCTGCAGACTC
11 PMC2708930.pdf CAGAGGATACCACTCCCAACAGAC
12 PMC2708930.pdf CCTTAGCCACTCCTTCTGTGACTC
13 PMC2708930.pdf CAGCTAGTTGTCATCCTGCTCTTC
14 PMC2708930.pdf GGTGCAGCTTATCGATGAATCCAG
15 PMC2708930.pdf GCTACACACTGCATCTTGGCTTTG
16 PMC2708930.pdf GTGGGTTGTTGACCTCAAACTTGG
17 PMC2708930.pdf CGTGCACTGAGGCTCACAAATGTTTC
18 PMC2708930.pdf TTTCTTGCACCAGCCATGAGC
19 PMC2708930.pdf CATGCTTCTGGGCCTGCTGTTC
20 PMC2708930.pdf CAGAAGTGCTTGAGGTGGTTGTGG
21 PMC2708930.pdf AAGGGGCCCAAGATCCGCTACA
22 PMC2708930.pdf GTAGACCCTGCGCTTCTCGTTCCA
23 PMC2708930.pdf GAGCACTGGCCACTCTTCAGAGTCAG
24 PMC2708930.pdf CGAGGAGTTCCCAGCAGAATCTCCAA
25 PMC2708930.pdf GGCTGAGGCCACCTCATATACTTC
26 PMC2708930.pdf TCCTTTGCCCTCAGCACAGTCAAG
27 PMC2708930.pdf GGTCTCCTCACACTGGCTTGGTTC
28 PMC2708930.pdf CAGTAGACCAGCTTCCGGTCACAG
29 PMC2708930.pdf GACCCGGATTCAGCGAAGCAACCA
30 PMC2708930.pdf CAGCTCCTCGTCACACCTGCACAA
31 PMC2708930.pdf GCTGGCCGGTATAACTGCAA
32 PMC2708930.pdf ACACAGTTGCCTTTCACACCA
33 PMC2708930.pdf ACCTCCCATTGCCCTGGCTT
34 PMC2708930.pdf GGCCCAGTACACAGCTTGTTGG
35 PMC2708930.pdf GGTTAAACACTCCACTGGACGGAA
36 PMC2708930.pdf CTCGGTACTTGTTCCTGTATGGGT
37 PMC2708930.pdf CGCTCCATTAAGCTGTGGTTTGTGATTCGG
38 PMC2708930.pdf AGACTGGCTCCTGGCTGCTTGATGATCTTC
Display recognized sequences in FASTA format