text2genome

About us

Related Links

Press Coverage

PubMed: 19129914    PubMedCentral: PMC2612748

Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response.

Chakraborty A, Uechi T, Higa S, Torihara H, Kenmochi N
PloS one, , 2009

Abstract:

Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs) play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants) displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:30190/egr2b
EntrezGene:30269/shha
EntrezGene:30380/nras
EntrezGene:30425/pax2a
EntrezGene:30501/otx2
EntrezGene:30567/pax6a
EntrezGene:30590/tp53
EntrezGene:30637/mdm2
EntrezGene:30686/myca
EntrezGene:58081/baxa
EntrezGene:58122/mcl1a
EntrezGene:114401/bcl2l
EntrezGene:403064/atm
EntrezGene:415229/rpl11
EntrezGene:431763/gadd45a
EntrezGene:564030/bik
EntrezGene:751763/bbc3
EntrezGene:751765/pmaip1
EntrezGene:100151416/cdkn1a
Genes found in fulltext (GNAT)
EntrezGene:1026/CDKN1A
EntrezGene:192300/rps18
EntrezGene:1959/EGR2
EntrezGene:22059/Trp53
EntrezGene:23212/RRS1
EntrezGene:23246/BOP1
EntrezGene:30425/pax2a
EntrezGene:30590/tp53
EntrezGene:336812/rpl23
EntrezGene:393723/rps19
EntrezGene:406686/rps11
EntrezGene:407690/rps8
EntrezGene:415229/rpl11
EntrezGene:4193/MDM2
EntrezGene:472/ATM
EntrezGene:5015/OTX2
EntrezGene:5076/PAX2
EntrezGene:6135/RPL11
EntrezGene:6165/RPL35A
EntrezGene:6208/RPS14
EntrezGene:6223/RPS19P3
EntrezGene:6229/RPS24
EntrezGene:6469/SHH
EntrezGene:68193/Rpl24
EntrezGene:7157/TP53

Best predicted genome from sequences: Danio rerio

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
tp53 ENSDARG00000035559 4,5
pak2a ENSDARG00000068177 6,7
gadd45a ENSDARG00000069991 8,9
mdm2 ENSDARG00000033443 10,11
bcl2l ENSDARG00000008434 12,13
mcl1a ENSDARG00000009779 14,15
baxa ENSDARG00000020623 18,19
pmaip1 ENSDARG00000071431 22,23
bactin1 ENSDARG00000037746 24,25
ENSDARG00000074405 26,27
myca ENSDARG00000045695 28,29
nras ENSDARG00000038225 30,31
rrs1 ENSDARG00000003941 32,33

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
24 chr1:6884357-6884377
35 chr5:10060489-10060510
26, 27 chr15:6620205-6625460
14 chr19:355293-355313
8, 9 chr6:25695009-25698386
7 chr2:34671651-34671671
12, 13 chr23:18400608-18401126
30, 31 chr8:10879114-10906432
10, 11 chr4:22929036-22929532
18, 19 chr3:34896835-34900448
16, 17 chr4:18658182-18660058
28, 29 chr24:10151968-10153524
4, 5 chr5:22123181-22126378
23 chr10:9168493-9168513
32, 33 chr24:23315596-23316674
20 chr15:23894147-23894167

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2612748.S1.doc CTTCTTCTCGCTCTGGTCCGCCATG
1 PMC2612748.S1.doc CTTgTTgTCGCTgTGcTCCGCgATG
2 PMC2612748.S1.doc ACCCATTTTGTGATCGTTTGTTCTC
3 PMC2612748.S1.doc ACCACGTCCTCTCTTAGACATAGTC
4 PMC2612748.S2.doc ACCACTGGGACCAAACGTAG
5 PMC2612748.S2.doc CAGAGTCGCTTCTTCCTTCG
6 PMC2612748.S2.doc CCAGTCAGAATGAGCAGCAC
7 PMC2612748.S2.doc CAGGTGCTGGAATAGGATCG
8 PMC2612748.S2.doc GGAGATAACGCAACGGAAAG
9 PMC2612748.S2.doc TTGCTTCTGTTCATCGTTCG
10 PMC2612748.S2.doc GGCTTCCAGAAACACACTCC
11 PMC2612748.S2.doc ACTGACTGAATGGGCTCTCG
12 PMC2612748.S2.doc CAGAGGAACTACCCCTGCAA
13 PMC2612748.S2.doc CATCCTCCTTGGCTTTGGAT
14 PMC2612748.S2.doc ACTCCGACGCTAAAGACGTG
15 PMC2612748.S2.doc GCCAGCTCTTGTTTTTGAGG
16 PMC2612748.S2.doc CTGGACCTGCTGAGGTTGA
17 PMC2612748.S2.doc TGTAGTGCTGCGAGACCAGT
18 PMC2612748.S2.doc GTGTGACCCCAGCCATAAAC
19 PMC2612748.S2.doc TCACCCTCTGTTCACCGTCT
20 PMC2612748.S2.doc GGAAAGCAGAGTGGACGAAC
21 PMC2612748.S2.doc GTCCCCGATTGTCCTCAGTT
22 PMC2612748.S2.doc ATGGCGAAGAAAGAGCAAAC
23 PMC2612748.S2.doc CGCTTCCCCTCCATTTGTAT
24 PMC2612748.S2.doc GCCCATCTATGAGGGTTACG
25 PMC2612748.S2.doc GCAAGATTCCATACCCAGGA
26 PMC2612748.S2.doc AACGTCACTTTCACCTGGCCGG
27 PMC2612748.S2.doc GTCAATGTGGACCAGTTCTGAGGT
28 PMC2612748.S2.doc AACAATTCTGGAACGGCATT
29 PMC2612748.S2.doc TAGTTGTGCTGGTGGGTGGA
30 PMC2612748.S2.doc CCCTCAGGACTGTAAGATGACTG
31 PMC2612748.S2.doc CGGTCACATGACTTCACAGG
32 PMC2612748.S2.doc AGAACCAAAATGGCTTCGTG
33 PMC2612748.S2.doc TCATAAGTCCACCACACTGCTT
34 PMC2612748.S2.doc ATCCTCATGAGCCCAGACAC
35 PMC2612748.S2.doc CCCTTCAGTAGGGAAGTGGTC
Display recognized sequences in FASTA format