text2genome

About us

Related Links

Press Coverage

PubMed: 14604435    PubMedCentral: PMC280659

Expressing functional siRNAs in mammalian cells using convergent transcription.

Tran N, Cairns MJ, Dawes IW, Arndt GM
BMC biotechnology, 21 , 2003

Abstract:

BACKGROUND: The use of small interfering RNAs (siRNAs) as genetic inhibitors of gene expression has been shown to be an effective way of studying gene function in mammalian cells. Recently, different DNA vectors for expression of small hairpin RNAs (shRNAs) or co-expression of sense and antisense RNAs have been developed that direct siRNA-mediated gene silencing. One expression cassette design that has been used to express long sense and antisense RNAs in non-mammalian cell types is symmetric transcription using convergent promoters. However, convergent transcription as a way to generate functional siRNAs in mammalian cells has not been reported. This vector design permits the generation of expression constructs containing no repeat sequences, but capable of inducing RNA interference (RNAi)-mediated gene silencing. RESULTS: With the aim of simplifying the construction of RNAi expression vectors, we report on the production and application of a novel convergent promoter cassette capable of expressing sense and antisense RNAs, that form double-stranded RNA, and mediate gene silencing in mammalian cells. We use this cassette to inhibit the expression of both the EGFP transgene and the endogenous TP53 gene. The gene silencing effect is Dicer-dependent and the level of gene inactivation achieved is comparable to that produced with synthetic siRNA. Furthermore, this expression system can be used for both short and long-term control of specific gene expression in mammalian cells. CONCLUSION: The experiments performed in this study demonstrate that convergent transcription can be used in mammalian cells to invoke gene-specific silencing via RNAi. This method provides an alternative to expression of shRNAs and co-expression of sense and antisense RNAs from independent cassettes or a divergent promoter. The main advantage of the present vector design is the potential to produce a functional siRNA expression cassette with no repeat sequences. Furthermore, the cassette design reported is ideal for both routine use in controlling specific gene expression and construction of randomised RNAi expression libraries for use in unbiased forward genetic selections.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:19106/Eif2ak2
EntrezGene:22059/Trp53
EntrezGene:23405/DICER1
EntrezGene:31/ACACA
EntrezGene:5610/EIF2AK2
EntrezGene:7157/TP53
EntrezGene:7462/LAT2
EntrezGene:788/SLC25A20

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 4,7,8

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
1 chr15:68132383-68132404
8 chr17:7577528-7577547

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC280659.pdf GCGCAAGCTTATAGGGAATTCGAGCTCGGTA
1 PMC280659.pdf GCGCTCTAGAGGTGTTTCGTCCTTTCCACAA
2 PMC280659.pdf TCGACAAAAACGGCAAGCTGACCCTGAAGTTTTT
3 PMC280659.pdf CTAGAAAAACTTCAGGGTCAGCTTGCCGTTTTTG
4 PMC280659.pdf TCGACAAAAAGACTCCAGTGGTAATCTACTTTTT
5 PMC280659.pdf CTAGAAAAAGTAGATTACCACTGGAGTCTTTTTG
6 PMC280659.pdf CGGCAAGCTGACCCTGAAG
7 PMC280659.pdf GACTCCAGTGGTAATCTAC
8 PMC280659.pdf GCATGAACCGGAGGCCCAT
9 PMC280659.pdf TCGACAAAAACGGCAAGCTGACCCTGAAGTTTTT
10 PMC280659.pdf CTAGAAAAACTTCAGGGTCAGCTTGCCGTTTTTG
11 PMC280659.pdf CTGCAGCAACTTTAATATACGCTATTGGAGCTGGAATTACCAAAAAAAA
Display recognized sequences in FASTA format