text2genome

About us

Related Links

Press Coverage

PubMed: 19064696    PubMedCentral: PMC2605231

Lung epithelial apoptosis in influenza virus pneumonia: the role of macrophage-expressed TNF-related apoptosis-inducing ligand.

Herold S, Steinmueller M, von Wulffen W, Cakarova L, Pinto R, Pleschka S, Mack M, Kuziel WA, Corazza N, Brunner T, Seeger W, Lohmeyer J
The Journal of experimental medicine, 3065 , 2008

Abstract:

Mononuclear phagocytes have been attributed a crucial role in the host defense toward influenza virus (IV), but their contribution to influenza-induced lung failure is incompletely understood. We demonstrate for the first time that lung-recruited "exudate" macrophages significantly contribute to alveolar epithelial cell (AEC) apoptosis by the release of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) in a murine model of influenza-induced pneumonia. Using CC-chemokine receptor 2-deficient (CCR2(-/-)) mice characterized by defective inflammatory macrophage recruitment, and blocking anti-CCR2 antibodies, we show that exudate macrophage accumulation in the lungs of influenza-infected mice is associated with pronounced AEC apoptosis and increased lung leakage and mortality. Among several proapoptotic mediators analyzed, TRAIL messenger RNA was found to be markedly up-regulated in alveolar exudate macrophages as compared with peripheral blood monocytes. Moreover, among the different alveolar-recruited leukocyte subsets, TRAIL protein was predominantly expressed on macrophages. Finally, abrogation of TRAIL signaling in exudate macrophages resulted in significantly reduced AEC apoptosis, attenuated lung leakage, and increased survival upon IV infection. Collectively, these findings demonstrate a key role for exudate macrophages in the induction of alveolar leakage and mortality in IV pneumonia. Epithelial cell apoptosis induced by TRAIL-expressing macrophages is identified as a major underlying mechanism.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:22035/Tnfsf10
Genes found in fulltext (GNAT)
EntrezGene:12504/Cd4
EntrezGene:12772/Ccr2
EntrezGene:16409/Itgam
EntrezGene:1760/DMPK
EntrezGene:1778/DYNC1H1
EntrezGene:19264/Ptprc
EntrezGene:213/ALB
EntrezGene:21926/Tnf
EntrezGene:21929/Tnfaip3
EntrezGene:21933/Tnfrsf10b
EntrezGene:24699/CD45_RAT
EntrezGene:308/ANXA5
EntrezGene:355/FAS
EntrezGene:3684/ITGAM
EntrezGene:3687/ITGAX
EntrezGene:4858/NOVA2
EntrezGene:5788/PTPRC
EntrezGene:6347/CCL2
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:8795/TNFRSF10B
EntrezGene:920/CD4

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 0,1
Fasl ENSMUSG00000000817 2,3
Tnfrsf10b ENSMUSG00000022074 6,7

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
6, 7 chr14:70175930-70177566
8 chr9:44149729-44149750
0, 1 chr17:35337378-35337847
2, 3 chr1:163711989-163717277

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2605231.pdf CATCTTCTCAAAATTCGAGTGACAA
1 PMC2605231.pdf TGGGAGTAGACAAGGTACAACCC
2 PMC2605231.pdf CCAACCAAAGCCTTAAAGTATCATC
3 PMC2605231.pdf AACCCAGTTTCGTTGATCACAA
4 PMC2605231.pdf GAAGACCTCAGAAAGTGGC
5 PMC2605231.pdf GACCAGCTCTCCATTCCTA
6 PMC2605231.pdf AAGTGTGTCTCCAAAACGG
7 PMC2605231.pdf AATGCACAGAGTTCGCACT
8 PMC2605231.pdf GGTACAAGGCTTTCAGCATCG
Display recognized sequences in FASTA format