text2genome

About us

Related Links

Press Coverage

PubMed: 19156198    PubMedCentral: PMC2617780

Circulating lipoproteins are a crucial component of host defense against invasive Salmonella typhimurium infection.

Netea MG, Joosten LA, Keuter M, Wagener F, Stalenhoef AF, van der Meer JW, Kullberg BJ
PloS one, , 2009

Abstract:

BACKGROUND: Circulating lipoproteins improve the outcome of severe Gram-negative infections through neutralizing lipopolysaccharides (LPS), thus inhibiting the release of proinflammatory cytokines. METHODS/PRINCIPAL FINDINGS: Low density lipoprotein receptor deficient (LDLR-/-) mice, with a 7-fold increase in LDL, are resistant against infection with Salmonella typhimurium (survival 100% vs 5%, p<0.001), and 100 to 1000-fold lower bacterial burden in the organs, compared with LDLR+/+ mice. Protection was not due to differences in cytokine production, phagocytosis, and killing of Salmonella organisms. The differences were caused by the excess of lipoproteins, as hyperlipoproteinemic ApoE-/- mice were also highly resistant to Salmonella infection. Lipoproteins protect against infection by interfering with the binding of Salmonella to host cells, and preventing organ invasion. This leads to an altered biodistribution of the microorganisms during the first hours of infection: after intravenous injection of Salmonella into LDLR+/+ mice, the bacteria invaded the liver and spleen within 30 minutes of infection. In contrast, in LDLR-/- mice, Salmonella remained constrained to the circulation from where they were efficiently cleared, with decreased organ invasion. CONCLUSIONS: plasma lipoproteins are a potent host defense mechanism against invasive Salmonella infection, by blocking adhesion of Salmonella to the host cells and subsequent tissue invasion.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:16835/Ldlr
Genes found in fulltext (GNAT)
EntrezGene:11816/Apoe
EntrezGene:16835/Ldlr
EntrezGene:21926/Tnf
EntrezGene:2597/GAPDH
EntrezGene:348/APOE
EntrezGene:3949/LDLR
EntrezGene:7099/TLR4
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 2,3
Il1a ENSMUSG00000027399 4,5
Il1b ENSMUSG00000027398 6,7

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0 chr13:67761794-67800429
2, 3 chr17:35337379-35338063
4, 5 chr2:129132244-129133652
6, 7 chr2:129193713-129195461
0, 1 chr6:93087028-93087564

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2617780.pdf AACTCCCTCAAGATTGTCAGCA
1 PMC2617780.pdf TCCACCACCCTGTTGCTGTA
2 PMC2617780.pdf TCTCATCAGTTCTATGGCCC
3 PMC2617780.pdf GGGAGTAGACAAGGTACAAC
4 PMC2617780.pdf CAGTTCTGCCATTGACCATC
5 PMC2617780.pdf TCTCACTGAAACTCAGCCGT
6 PMC2617780.pdf TTGACGGACCCCAAAAGATG
7 PMC2617780.pdf AGAAGGTGCTCATGTCCTCA
Display recognized sequences in FASTA format