text2genome

About us

Related Links

Press Coverage

PubMed: 17537232    PubMedCentral: PMC1929098

Association of TP53 codon 72 polymorphism and the outcome of adjuvant therapy in breast cancer patients.

Toyama T, Zhang Z, Nishio M, Hamaguchi M, Kondo N, Iwase H, Iwata H, Takahashi S, Yamashita H, Fujii Y
Breast cancer research : BCR, R34 , 2007

Abstract:

INTRODUCTION: Single-nucleotide polymorphisms (SNPs) in codon 72 of the TP53 (also known as p53) gene (rs1042522) and in the promoter region of the MDM2 gene (SNP309; rs2279744) have been suggested to play roles in many cancers. We investigated whether these SNPs were associated with patient outcome and the effect of adjuvant systemic therapy. METHODS: The genotypes of TP53 codon 72 and MDM2 SNP309 were defined among 557 primary Japanese breast cancer patients (median follow-up, 61.7 months). The effects of several variables on survival were tested by Cox's proportional hazards regression analysis. RESULTS: We showed that the Pro/Pro genotype of TP53 codon 72 was associated with poorer disease-free survival (DFS) than other genotypes by Kaplan-Meier analysis (P = 0.049) and multivariate Cox's proportional hazards regression analysis (P = 0.047, risk ratio of recurrence = 1.67), whereas MDM2 SNP309 status was not associated with DFS. The association of the Pro/Pro TP53 genotype with poorer DFS was especially significant in patients who received adjuvant chemotherapy (P = 0.009). In contrast, among the patients who had received adjuvant hormonal therapy or no adjuvant systemic therapy, TP53 codon 72 genotype was not associated with DFS. CONCLUSION: The Pro/Pro genotype of TP53 codon 72 appears to be an independent prognostic marker in breast cancer patients.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:4193/MDM2
EntrezGene:7157/TP53
Genes found in fulltext (GNAT)
EntrezGene:1588/CYP19A1
EntrezGene:17246/Mdm2
EntrezGene:22059/Trp53
EntrezGene:4193/MDM2
EntrezGene:4838/NODAL
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 1,2

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0 chr12:69202620-69202640
1, 2 chr17:7579337-7579549

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1929098.pdf GCGCAGCGTTCACACTAGTG
1 PMC1929098.pdf CCCGGACGATATTGAACAATGG
2 PMC1929098.pdf CAGAATGCAAGAAGCCCAGAC
Display recognized sequences in FASTA format