text2genome

About us

Related Links

Press Coverage

PubMed: 19771240    PubMedCentral: PMC2737241

Differential regulation of gene expression in mouse spermatogonial cells after blocking c-kit-SCF interaction with RNAi.

Sikarwar AP, Rambabu MK, Reddy KV
Journal of RNAi and gene silencing : an international journal of RNA and gene targeting research, 302 , 2008

Abstract:

c-Kit, the gene product of the W locus is a receptor tyrosine kinase that regulates the survival, growth and differentiation of spermatogonial cells (SGCs). Stem cell factor (SCF), the gene product of the steel (Sl) locus is the ligand for c-kit. Normal function of SGCs requires cross-talk between c-kit and SCF through which the receptor-ligand pair regulates the functions of SGCs. The implications of cross-talk between c-kit and SCF in regulating SGC function remains unclear due to the molecular complexity of this interaction. In the present study, we analyzed the interactions between c-kit and SCF in mouse primary SGCs after blocking the c-kit expression by c-kit siRNA and its effect on cell fate were determined using cDNA Expression Array and Real-time PCR. Immunofluorescence (IF) and western blot studies revealed that c-kit protein was detected in SGCs and knocked down to undetectable levels at 24 hr post transfection with 10 nM concentration of c-kit siRNA. We further demonstrated that expression of various genes involved in cell signaling, cell differentiation, apoptosis and cell cycle pathways was altered. SGC functions are affected by SCF signaling through c-kit receptor and this signaling appears to be important to maintain balance between cell proliferation and apoptosis along with the modulation of inflammatory responses of SGCs. To the best of our knowledge, this is the first report that identifies the putative molecular pathways in murine SGCs in response to specific blocking of c-kit-SCF interactions by siRNA. In conclusion, the present study may provide useful insights into siRNA function and hopefully aid in understanding the involvement of c-kit in the early events of SGC activities and spermatogenesis in mice.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Mus musculus
Homo sapiens
Bos taurus
Capra hircus
Felis catus
Rattus norvegicus
Genes found in fulltext (GNAT)
EntrezGene:1603/DAD1
EntrezGene:16590/Kit
EntrezGene:17311/Kitl
EntrezGene:2597/GAPDH
EntrezGene:355/FAS
EntrezGene:3815/KIT
EntrezGene:4254/KITLG
EntrezGene:4858/NOVA2
EntrezGene:5460/POU5F1
EntrezGene:5460/POU5F1
EntrezGene:5460/POU5F1
EntrezGene:5460/POU5F1
EntrezGene:5460/POU5F1
EntrezGene:5460/POU5F1
EntrezGene:5460/POU5F1
EntrezGene:6236/RRAD
EntrezGene:7157/TP53
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:890/CCNA2
EntrezGene:9414/TJP2

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Rbmy1a1 ENSMUSG00000052831 2,3
Wt1 ENSMUSG00000016458 5,6
Ccnd3 ENSMUSG00000034165 9,10
Cdk4 ENSMUSG00000006728 11,12
Pou5f1 ENSMUSG00000024406 13,14
Fas ENSMUSG00000024778 16,17
Pik3ap1 ENSMUSG00000025017 18,19
Trp53 ENSMUSG00000059552 20,21
Gapdh ENSMUSG00000057666 22,23

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
21 chr11:69400874-69400894
18, 19 chr19:41399106-41402662
7, 8 chr14:63762036-63762334
22, 23 chr2:11330716-11342798
11 chr14:91599095-91599117
13, 14 chr17:35646093-35647334
15 chr3:36469708-36469727
12 chr10:126504209-126504231
16, 17 chr19:34401507-34401821
9, 10 chr17:47736210-47736488
6 chr2:104967157-104967178
2, 3 chrY:2097194-2167755
1 chr5:76019102-76019121

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2737241.pdf CCGTGACATTCAAGCTTTA
1 PMC2737241.pdf TAAACGTTGAATGTCACGG
2 PMC2737241.pdf AACCGAAGTAACATATACTCA
3 PMC2737241.pdf ATCTGCTTTCTCCACGACCTC
4 PMC2737241.pdf TCAAAATCTCGATGTCGCAAA
5 PMC2737241.pdf AGCAGCCATTCCCTTTAAGGT
6 PMC2737241.pdf ATGGGTTCCGACGTGCGGGAC
7 PMC2737241.pdf GTCACCCTCAGAAATGGTTCTC
8 PMC2737241.pdf AGATCCATAGGACAACGCTGAT
9 PMC2737241.pdf CAGAGCAAGAACCCATACACTG
10 PMC2737241.pdf CTGCTCTGATGAAGATGAGGTG
11 PMC2737241.pdf CTGGAAATGCTGACCTTTAACC
12 PMC2737241.pdf GTGAACCTCGTAAGGAGAGGTG
13 PMC2737241.pdf AGCTGCTGAAGCAGAAGAGG
14 PMC2737241.pdf TGGGAAAGGTGTCCCTGTAG
15 PMC2737241.pdf CGGGTAAAGAGACAGCTGC
16 PMC2737241.pdf GAGAATTGCTGAAGACATGACAAT
17 PMC2737241.pdf GTAGTTTTCACTCCAGACATTGTC
18 PMC2737241.pdf ACCGTCAGCTATTATACCGACAT
19 PMC2737241.pdf GAGGTTCTTCAGTCCATACTTGG
20 PMC2737241.pdf GCTTCTCCGAAGACTGGATG
21 PMC2737241.pdf GTCCATGCAGTGAGGTGATG
22 PMC2737241.pdf GAAACCTGCCAAGTATGATGAC
23 PMC2737241.pdf ATTGTCATACCAGGAAATGAGC
Display recognized sequences in FASTA format