text2genome

About us

Related Links

Press Coverage

PubMed: 18348728    PubMedCentral: PMC2373291

Increased systemic and brain cytokine production and neuroinflammation by endotoxin following ethanol treatment.

Qin L, He J, Hanes RN, Pluzarev O, Hong JS, Crews FT
Journal of neuroinflammation, 10 , 2008

Abstract:

BACKGROUND: Cytokines and alcohol share a common modulation of inflammation and hormones as well as being implicated in multiple diseases, but the mechanisms are poorly understood. The purpose of this study was to investigate the interaction of liver, serum and brain cytokines as well as whether ethanol would potentiate endotoxin (Lipopolysaccharide, LPS) responses once ethanol had cleared. METHODS: Male C57BL/6J mice were treated intragastrically with water (control) or ethanol (5 g/kg, i.g., 25% ethanol, w/v), with volumes matched, for 1 day or daily for 10 days. Mice were then injected intraperitoneally with saline (control) or LPS (3 mg/kg, i.p.) in saline 24 hrs after the last dose of ethanol. Gene expression and protein synthesis of proinflammatory cytokines and anti-inflammatory cytokine, oxidative enzymes, microglial activation and inhibition of neurogenesis were examined using real-time PCR, ELISA, and immunohistochemistry. RESULTS: LPS increased proinflammatory cytokines (TNFalpha, MCP-1, IL-1beta) several fold in liver, brain and serum at 1 hr. Ethanol is known to increase liver cytokines and alter the risk of multiple chronic diseases. Ten daily doses of ethanol increased brain and liver TNFalpha, and pretreatment with ethanol potentiated LPS-induced increases in TNFalpha, MCP-1, IL-1beta in liver, serum and brain. Proinflammatory cytokine levels in liver and serum returned to basal levels within a day, whereas brain proinflammatory cytokines remained elevated for long periods. IL-10, an anti-inflammatory cytokine, is reduced in brain by ethanol and LPS, while brain proinflammatory cytokines remain increased, whereas liver IL-10 is increased when proinflammatory cytokines have returned to control levels. Activation of brain microglia indicated by morphological changes, reduced neurogenesis and increased brain expression of COX-2 and gp91phox NADPH oxidase subunit mRNA were found in the 10 daily doses of ethanol-pretreated LPS group. CONCLUSION: Acute increases in serum cytokines induce long lasting increases in brain proinflammatory cytokines. Ten daily doses of ethanol exposure results in persistent alterations of cytokines and significantly increases the magnitude and duration of central and peripheral proinflammatory cytokines and microglial activation. Ethanol induced differential anti-inflammatory cytokine IL-10 responses in liver and brain could cause long lasting disruption of cytokine cascades that could contribute to protection or increased risk of multiple chronic diseases.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Mus sp.
Homo sapiens
Hepatitis C virus
Human immunodeficiency virus
Oryctolagus cuniculus
Mus musculus
Capra hircus
Rattus norvegicus
Sus scrofa
Lateolabrax japonicus
Genes found in fulltext (GNAT)
EntrezGene:12/SERPINA3
EntrezGene:1536/CYBB
EntrezGene:16153/Il10
EntrezGene:199/AIF1
EntrezGene:199/AIF1
EntrezGene:199/AIF1
EntrezGene:199/AIF1
EntrezGene:199/AIF1
EntrezGene:199/AIF1
EntrezGene:21926/Tnf
EntrezGene:24498/IL6_RAT
EntrezGene:27035/NOX1
EntrezGene:31/ACACA
EntrezGene:3569/IL6
EntrezGene:3586/IL10
EntrezGene:3952/LEP
EntrezGene:5111/PCNA
EntrezGene:57120/GOPC
EntrezGene:60/ACTB
EntrezGene:60350/CD14_RAT
EntrezGene:6050/RNH1
EntrezGene:6347/CCL2
EntrezGene:6899/TBX1
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:788/SLC25A20

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 0,1
Ptgs2 ENSMUSG00000032487 5,6
Cybb ENSMUSG00000015340 7,8
Ncf2 ENSMUSG00000026480 9,10
Dbi ENSMUSG00000026385 11,12
Il10 ENSMUSG00000016529 13,14
Gapdh ENSMUSG00000057666 15,16

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
15, 16 chr3:121933876-121933977
15, 16 chr7:59002203-59002304
13, 14 chr1:132917914-132919112
15, 16 chr11:20235778-20235879
5, 6 chr1:151953870-151954001
15, 16 chr11:26686769-26686870
1 chr17:35337490-35337510
15, 16 chr4:91519122-91519223
12 chr11:54013227-54013247
9, 10 chr13:112672718-112673064
12 chr1:122009983-122010003
15, 16 chrX:77439953-77440054
2 chr2:129193083-129193105
15, 16 chr3:139312479-139312580
15, 16 chr2:28789891-28789992
15, 16 chr6:128153013-128153114
7 chrX:9023830-9023850
15, 16 chr15:12504780-12504881
15, 16 chr5:106292483-106292584
15, 16 chr2:11331420-11331521
9, 10 chr1:154680995-154682329
15, 16 chr6:125113239-125113340
15, 16 chr4:57384588-57384689
15, 16 chr5:96290869-96290970
3 chr11:81849132-81849156

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2373291.pdf GACCCTCACACTCAGATCATCTTCT
1 PMC2373291.pdf CCTCCACTTGGTGGTTTGCT
2 PMC2373291.pdf CTGGTGTGTGACGTTCCCATTA
3 PMC2373291.pdf ACTGAAGCCAGCTCTCTCTTCCTC
4 PMC2373291.pdf ACTGAAGCCAGCTCTCTCTTCCTC
5 PMC2373291.pdf GCTGGCCTGGTACTCAGTAGGTT
6 PMC2373291.pdf CGAGGCCACTGATACCTATTGC
7 PMC2373291.pdf CAGGAGTTCCAAGATGCCTG
8 PMC2373291.pdf GATTGGCCTGAGATTCATCC
9 PMC2373291.pdf CAGCCAGCTTCGGAACATG
10 PMC2373291.pdf GACAGTACCAGGATTACATC
11 PMC2373291.pdf GCCAGTATGTCTCAGGCTGA
12 PMC2373291.pdf AGGCATTATGTCCTCACAGG
13 PMC2373291.pdf GGTTGCCAAGCCTTATCGGA
14 PMC2373291.pdf ACCTGCTCCACTGCCTTGCT
15 PMC2373291.pdf GTATGACTCCACTCACGGCAAA
16 PMC2373291.pdf GGTCTCGCTCCTGGAAGATG
Display recognized sequences in FASTA format