text2genome

About us

Related Links

Press Coverage

PubMed: 19680549    PubMedCentral: PMC2721630

Timed somatic deletion of p53 in mice reveals age-associated differences in tumor progression.

Hinkal G, Parikh N, Donehower LA
PloS one, , 2009

Abstract:

Inactivating mutations in the p53 tumor suppressor gene occur often in the progression of human cancers. p53 inhibits the outgrowth of nascent cancer cells through anti-proliferative actions (including induction of apoptosis or senescence). To test p53 tumor suppressor functions in a novel experimental context, we somatically deleted both p53 alleles in multiple tissues of mice at various ages. Mice homozygously deleted for p53 at 3 months of age showed a longer tumor latency compared to mice deleted for p53 at 6 and 12 months of age. These results are consistent with a model in which tissues accumulate oncogenically activated cells with age and these are held in check by wildtype p53. We also deleted p53 before, concurrent with, and after treatment of mice with ionizing radiation (IR). The absence or presence of p53 during IR treatment had no effect on radiation-induced lymphoma latency, confirming that the immediate p53 damage response was irrelevant for cancer prevention. Even the presence of wildtype p53 for up to four weeks post-IR provided no protection against early lymphoma incidence, indicating that long term maintenance of functional p53 is critical for preventing the emergence of a cancer. These experiments indicate that sustained p53 anti-oncogenic function acts as a final or near final line of defense preventing progression of oncogenically activated cells to malignant tumors.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:22059/Trp53
Genes found in fulltext (GNAT)
EntrezGene:1029/CDKN2A
EntrezGene:11979/Atp7b
EntrezGene:12575/Cdkn1a
EntrezGene:17251/Mds1
EntrezGene:2153/F5
EntrezGene:22059/Trp53
EntrezGene:7157/TP53

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Trp53 ENSMUSG00000059552 5,6

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
3, 5, 6 chr11:69404825-69405241

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2721630.pdf AAGAACCTGATGGACATGTTCAGGG
1 PMC2721630.pdf CCAGACCAGGCCAGGTATCTCT
2 PMC2721630.pdf AAGGGGTATGAGGGACAAGG
3 PMC2721630.pdf GAAGACAGAAAAGGGGAGGG
4 PMC2721630.pdf CACAAAAACAGGTTAAACCCAG
5 PMC2721630.pdf CTACCTGAAGACCAAGAAGG
6 PMC2721630.pdf TGGAGGATATGGACCCTATG
Display recognized sequences in FASTA format