text2genome

About us

Related Links

Press Coverage

PubMed: 19863797    PubMedCentral: PMC2774661

Analysis of knockout mice suggests a role for VGF in the control of fat storage and energy expenditure.

Watson E, Fargali S, Okamoto H, Sadahiro M, Gordon RE, Chakraborty T, Sleeman MW, Salton SR
BMC physiology, 19 , 2009

Abstract:

BACKGROUND: Previous studies of mixed background mice have demonstrated that targeted deletion of Vgf produces a lean, hypermetabolic mouse that is resistant to diet-, lesion-, and genetically-induced obesity. To investigate potential mechanism(s) and site(s) of action of VGF, a neuronal and endocrine secreted protein and neuropeptide precursor, we further analyzed the metabolic phenotypes of two independent VGF knockout lines on C57Bl6 backgrounds. RESULTS: Unlike hyperactive VGF knockout mice on a mixed C57Bl6-129/SvJ background, homozygous mutant mice on a C57Bl6 background were hypermetabolic with similar locomotor activity levels to Vgf+/Vgf+ mice, during day and night cycles, indicating that mechanism(s) other than hyperactivity were responsible for their increased energy expenditure. In Vgf-/Vgf- knockout mice, morphological analysis of brown and white adipose tissues (BAT and WAT) indicated decreased fat storage in both tissues, and decreased adipocyte perimeter and area in WAT. Changes in gene expression measured by real-time RT-PCR were consistent with increased fatty acid oxidation and uptake in BAT, and increased lipolysis, decreased lipogenesis, and brown adipocyte differentiation in WAT, suggesting that increased sympathetic nervous system activity in Vgf-/Vgf- mice may be associated with or responsible for alterations in energy expenditure and fat storage. In addition, uncoupling protein 1 (UCP1) and UCP2 protein levels, mitochondrial number, and mitochondrial cristae density were upregulated in Vgf-/Vgf- BAT. Using immunohistochemical and histochemical techniques, we detected VGF in nerve fibers innervating BAT and Vgf promoter-driven reporter expression in cervical and thoracic spinal ganglia that project to and innervate the chest wall and tissues including BAT. Moreover, VGF peptide levels were quantified by radioimmunoassay in BAT, and were found to be down-regulated by a high fat diet. Lastly, despite being hypermetabolic, VGF knockout mice were cold intolerant. CONCLUSION: We propose that VGF and/or VGF-derived peptides modulate sympathetic outflow pathways to regulate fat storage and energy expenditure.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:381677/Vgf
Species found in fulltext (Linnaeus)
Mus musculus
Mus sp.
Homo sapiens
Vasconcellea candicans
Mesocricetus auratus
Suid herpesvirus 1
Phodopus sungorus
Oryctolagus cuniculus
Capra hircus
Equus caballus
Rattus norvegicus
Sus scrofa
Escherichia coli
Genes found in fulltext (GNAT)
EntrezGene:109648/Npy
EntrezGene:11604/Agrp
EntrezGene:11657/Alb
EntrezGene:12012/Baat
EntrezGene:13166/Dbh
EntrezGene:13350/Dgat1
EntrezGene:1374/CPT1A
EntrezGene:14102/Fas
EntrezGene:14732/Gpam
EntrezGene:16846/Lep
EntrezGene:16890/Lipe
EntrezGene:16956/Lpl
EntrezGene:17202/Mc4r
EntrezGene:18976/Pomc
EntrezGene:19017/Ppargc1a
EntrezGene:22227/Ucp1
EntrezGene:22228/Ucp2
EntrezGene:31/ACACA
EntrezGene:381677/Vgf
EntrezGene:3952/LEP
EntrezGene:3991/LIPE
EntrezGene:4023/LPL
EntrezGene:4160/MC4R
EntrezGene:4852/NPY
EntrezGene:5471/PPAT
EntrezGene:570/BAAT
EntrezGene:6517/SLC2A4
EntrezGene:7350/UCP1
EntrezGene:7351/UCP2
EntrezGene:7352/UCP3
EntrezGene:7425/VGF
EntrezGene:9370/ADIPOQ

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Adrb1 ENSMUSG00000035283 1,2
Adrb2 ENSMUSG00000045730 3,4
Adrb3 ENSMUSG00000031489 5,6
Insr ENSMUSG00000005534 17,18
Irs2 ENSMUSG00000038894 21,22
Pparg ENSMUSG00000000440 25,26
Ppargc1a ENSMUSG00000029167 27,28
Tnf ENSMUSG00000024401 29,30
Ucp1 ENSMUSG00000031710 31,32

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
27, 28 chr5:51864775-51865081
9, 10 chr1:24621760-24622395
19 chr15:93794825-93795293
34 chr5:143666389-143666409
25, 26 chr6:115413127-115422978
23, 24 chr15:85628235-85628547
34 chr16:37883011-37883031
19 chr2:130295365-130295476
0 chr11:84205833-84205857
3, 4 chr18:62338248-62338720
14 chr19:55149156-55149176
34 chrX:36466356-36466376
1, 2 chr19:56797122-56797460
20 chr1:82287046-82287068
0 chr12:10164722-10164746
16 chr12:25780822-25780843
21, 22 chr8:11004687-11005263
31, 32 chr8:85815299-85817976
5, 6 chr8:28338223-28338536
29, 30 chr17:35338055-35338743
17, 18 chr8:3192767-3204659

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2774661.pdf ACCCAGATCCAGGCCATGTTGAGACG
1 PMC2774661.pdf CGGCTGCAGACGCTCACCAA
2 PMC2774661.pdf CGCCACCAGTGCATGAGGAT
3 PMC2774661.pdf GCTGCAGAAGATAGACAAAT
4 PMC2774661.pdf GGGATCCTCACACAGCAGTT
5 PMC2774661.pdf CTGCTAGCATCGAGACCTT
6 PMC2774661.pdf CGAGCATAGACGAAGAGCAT
7 PMC2774661.pdf ACCACTGGCCGAATGTCACAA
8 PMC2774661.pdf AGCGCGTAGCGCATGGTCAT
9 PMC2774661.pdf CGATTCCAACTTGGTCTACAA
10 PMC2774661.pdf GGAACCATTTCTAGGACAATG
11 PMC2774661.pdf GCCCGGTAGCTCTGGGTGTA
12 PMC2774661.pdf CTCAGCAGCGAGTGACTGGGAC
13 PMC2774661.pdf CCCTGAGTAGGCGCCAATGAGG
14 PMC2774661.pdf CAGCTCTGCTGCCATCTTTG
15 PMC2774661.pdf TGCAGCTTCTGCAGGTACTCA
16 PMC2774661.pdf GAAAAACAGCCTGTCGGACCA
17 PMC2774661.pdf GTAGCCTGATCATCAACATCCG
18 PMC2774661.pdf CCTGCCCATCAAACTCTGTCAC
19 PMC2774661.pdf CCTCTCCAACGCCAGAAGCTGCC
20 PMC2774661.pdf ATGGCGAGCCCTCCGGATACCG
21 PMC2774661.pdf GGATAATGGTGACTATACCGAGA
22 PMC2774661.pdf CTCACATCGATGGCGATATAGTT
23 PMC2774661.pdf TCCCTTGTAGCCTTTTGTCAT
24 PMC2774661.pdf AAGCCATTGCCGTACGCGAT
25 PMC2774661.pdf AGGCCGAGAAGGAGAAGCTGTTG
26 PMC2774661.pdf TGGCCACCTCTTTGCTCTGCTC
27 PMC2774661.pdf AAAGAATTCGAACTAAGGGATGGCGACTT
28 PMC2774661.pdf ATAGGATCCGGAATATGGTGATCGGGAAC
29 PMC2774661.pdf GAGGCACTCCCCCAAAAGAT
30 PMC2774661.pdf TGATGAGAGGGAGGCCATTT
31 PMC2774661.pdf GATCCAAGGTGAAGGCCAGG
32 PMC2774661.pdf GTTGACAAGCTTTCTGTGG
33 PMC2774661.pdf GTGACCTGCTGCGCTGTGGTACT
34 PMC2774661.pdf TGCTGTCCCTGTATGCCTCT
35 PMC2774661.pdf AGGTCTTTACGGATGTCACG
Display recognized sequences in FASTA format