text2genome

About us

Related Links

Press Coverage

PubMed: 19695094    PubMedCentral: PMC2745810

Increased expression of matrix metalloproteinase-10, nerve growth factor and substance P in the painful degenerate intervertebral disc.

Richardson SM, Doyle P, Minogue BM, Gnanalingham K, Hoyland JA
Arthritis research & therapy, R126 , 2009

Abstract:

INTRODUCTION: Matrix metalloproteinases (MMPs) are known to be involved in the degradation of the nucleus pulposus (NP) during intervertebral disc (IVD) degeneration. This study investigated MMP-10 (stromelysin-2) expression in the NP during IVD degeneration and correlated its expression with pro-inflammatory cytokines and molecules involved in innervation and nociception during degeneration which results in low back pain (LBP). METHODS: Human NP tissue was obtained at postmortem (PM) from patients without a history of back pain and graded as histologically normal or degenerate. Symptomatic degenerate NP samples were also obtained at surgery for LBP. Expression of MMP-10 mRNA and protein was analysed using real-time polymerase chain reaction and immunohistochemistry. Gene expression for pro-inflammatory cytokines interleukin-1 (IL-1) and tumour necrosis factor-alpha (TNF-alpha), nerve growth factor (NGF) and the pain-associated neuropeptide substance P were also analysed. Correlations between MMP-10 and IL-1, TNF-alpha and NGF were assessed along with NGF with substance P. RESULTS: MMP-10 mRNA was significantly increased in surgical degenerate NP when compared to PM normal and PM degenerate samples. MMP-10 protein was also significantly higher in degenerate surgical NP samples compared to PM normal. IL-1 and MMP-10 mRNA demonstrated a significant correlation in surgical degenerate samples, while TNF-alpha was not correlated with MMP-10 mRNA. NGF was significantly correlated with both MMP-10 and substance P mRNA in surgical degenerate NP samples. CONCLUSIONS: MMP-10 expression is increased in the symptomatic degenerate IVD, where it may contribute to matrix degradation and initiation of nociception. Importantly, this study suggests differences in the pathways involved in matrix degradation between painful and pain-free IVD degeneration.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:4319/MMP10
EntrezGene:4803/NGF
EntrezGene:6863/TAC1
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
Genes found in fulltext (GNAT)
EntrezGene:1962/EHHADH
EntrezGene:2597/GAPDH
EntrezGene:4312/MMP1
EntrezGene:4314/MMP3
EntrezGene:4319/MMP10
EntrezGene:4320/MMP11
EntrezGene:4803/NGF
EntrezGene:6863/TAC1
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
MMP10 ENSG00000166670 0,1
IL1B ENSG00000125538 2,3
TNF ENSG00000204490 4,5
TNF ENSG00000206439 4,5
TNF ENSG00000223952 4,5
TNF ENSG00000228321 4,5
TNF ENSG00000228849 4,5
TNF ENSG00000230108 4,5
TNF ENSG00000232810 4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
4, 5 HSCHR6_MHC_MANN:31584807-31584956
4, 5 HSCHR6_MHC_SSTO:31535263-31535412
4, 5 HSCHR6_MHC_QBL:31535563-31535712
0, 1 chr11:102643588-102643678
2 chr2:113587639-113587660
4, 5 chr6:31545320-31545469
4, 5 HSCHR6_MHC_DBB:31527464-31527613
4, 5 HSCHR6_MHC_COX:31532732-31532881
4, 5 HSCHR6_MHC_MCF:31621629-31621778
4, 5 HSCHR6_MHC_APD:31556641-31556790

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2745810.pdf CATACCCTGGGTTTTCCTCCAA
1 PMC2745810.pdf GTCCGCTGCAAAGAAGTATGTTTTC
2 PMC2745810.pdf CGGCCACATTTGGTTCTAAGA
3 PMC2745810.pdf AGGGAAGCGGTTGCTCATC
4 PMC2745810.pdf CGAACATCCAACCTTCCCAAC
5 PMC2745810.pdf TGGTGGTCTTGTTGCTTAAAGTTC
Display recognized sequences in FASTA format