text2genome

About us

Related Links

Press Coverage

PubMed: 19735566    PubMedCentral: PMC2787298

Advanced glycation end products induce cell cycle arrest and proinflammatory changes in osteoarthritic fibroblast-like synovial cells.

Franke S, Sommer M, RĂ¼ster C, Bondeva T, Marticke J, Hofmann G, Hein G, Wolf G
Arthritis research & therapy, R136 , 2009

Abstract:

INTRODUCTION: Advanced glycation end products (AGEs) have been introduced to be involved in the pathogenesis of osteoarthritis (OA). The influence of AGEs on osteoarthritic fibroblast-like synovial cells (FLS) has been incompletely understood as yet. The present study investigates a potential influence of AGE-modified bovine serum albumin (AGE-BSA) on cell growth, and on the expression of proinflammatory and osteoclastogenic markers in cultured FLS. METHODS: FLS were established from OA joints and stimulated with AGE-BSA. The mRNA expression of p27Kip1, RAGE (receptor for AGEs), nuclear factor kappa B subunit p65 (NFkappaB p65), tumor necrosis factor alpha (TNF-alpha, interleukin-6 (IL-6), receptor activator of NFkappaB ligand (RANKL) and osteoprotegerin was measured by real-time PCR. The respective protein expression was evaluated by western blot analysis or ELISA. NFkappaB activation was investigated by luciferase assay and electrophoretic mobility shift assay (EMSA). Cell cycle analysis, cell proliferation and markers of necrosis and early apoptosis were assessed. The specificity of the response was tested in the presence of an anti-RAGE antibody. RESULTS: AGE-BSA was actively taken up into the cells as determined by immunohistochemistry and western blots. AGE-induced p27Kip1 mRNA and protein expression was associated with cell cycle arrest and an increase in necrotic, but not apoptotic cells. NFkappaB activation was confirmed by EMSAs including supershift experiments. Anti-RAGE antibodies attenuated all AGE-BSA induced responses. The increased expression of RAGE, IL-6 and TNF-alpha together with NFkappaB activation indicates AGE-mediated inflammation. The decreased expression of RANKL and osteoprotegerin may reflect a diminished osteoclastogenic potential. CONCLUSIONS: The present study demonstrates that AGEs modulate growth and expression of genes involved in the pathophysiological process of OA. This may lead to functional and structural impairment of the joints.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1027/CDKN1B
EntrezGene:213/ALB
EntrezGene:2597/GAPDH
EntrezGene:308/ANXA5
EntrezGene:3569/IL6
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:83881/MIXL1
EntrezGene:8600/TNFSF11

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
GAPDH ENSG00000111640 0,1
IL6 ENSG00000136244 2,3
RELA ENSG00000173039 4,5
TNFRSF11B ENSG00000164761 6,7
CDKN1B ENSG00000111276 8,9
AGER ENSG00000204305 10,11
AGER ENSG00000229058 10,11
TNFSF11 ENSG00000120659 12,13
TNF ENSG00000204490 14,15
TNF ENSG00000206439 14,15
TNF ENSG00000223952 14,15
TNF ENSG00000228321 14,15
TNF ENSG00000228849 14,15
TNF ENSG00000230108 14,15
TNF ENSG00000232810 14,15

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
12, 13 chr13:43175061-43180768
15 HSCHR6_MHC_COX:31532421-31532443
0, 1 chrX:46299853-46300051
6, 7 chr8:119941124-119945301
8, 9 chr12:12870771-12870925
10, 11 HSCHR6_MHC_MANN:32190344-32190798
10, 11 chr6:32150917-32151371
15 HSCHR6_MHC_APD:31556330-31556352
5 chr11:65422430-65422452
15 chr6:31545009-31545031
10, 11 HSCHR6_MHC_SSTO:32157787-32158241
15 HSCHR6_MHC_MCF:31621318-31621340
15 HSCHR6_MHC_DBB:31527153-31527175
15 HSCHR6_MHC_MANN:31584496-31584518
2, 3 chr7:22769162-22771140
10, 11 HSCHR6_MHC_APD:32162261-32162715
15 HSCHR6_MHC_SSTO:31534952-31534974
10, 11 HSCHR6_MHC_MCF:32227347-32227801
0, 1 chr12:6645728-6646144
10, 11 HSCHR6_MHC_COX:32099394-32099848
15 HSCHR6_MHC_QBL:31535252-31535274
10, 11 HSCHR6_MHC_QBL:32108540-32108994

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2787298.pdf CAATGACCCCTTCATTGACC
1 PMC2787298.pdf TGGACTCCACGACGTACTCA
2 PMC2787298.pdf CTTTTGGAGTTTGAGGTATACCTAG
3 PMC2787298.pdf CGCAGAATGAGATGAGTTGTC
4 PMC2787298.pdf AGTACCTGCCAGATACAGACGAT
5 PMC2787298.pdf GATGGTGCTCAGGGATGACGTA
6 PMC2787298.pdf TGCAGTACGTCAAGCAGGAG
7 PMC2787298.pdf CCCATCTGGACATCTTTTGC
8 PMC2787298.pdf AGATGTCAAACGTGCGAGTG
9 PMC2787298.pdf TCTCTGCAGTGCTTCTCCAA
10 PMC2787298.pdf GGAAAGGAGACCAAGTCCAA
11 PMC2787298.pdf CATCCAAGTGCCAGCTAAGA
12 PMC2787298.pdf GCTTGAAGCTCAGCCTTTTG
13 PMC2787298.pdf CGAAAGCAAATGTTGGCATA
14 PMC2787298.pdf GGCAGTCAGATCATCTTCTCGAA
15 PMC2787298.pdf AAGAGGACCTGGGAGTAGATGA
16 PMC2787298.pdf GAAAGTTGAGGGGACTTTCAGTTGAGGCGACTTTCCCAGGCCGCTTGATGACTCAGCCG
Display recognized sequences in FASTA format