text2genome

About us

Related Links

Press Coverage

PubMed: 19445683    PubMedCentral: PMC2714117

Green tea polyphenol epigallocatechin-3-gallate inhibits advanced glycation end product-induced expression of tumor necrosis factor-alpha and matrix metalloproteinase-13 in human chondrocytes.

Rasheed Z, Anbazhagan AN, Akhtar N, Ramamurthy S, Voss FR, Haqqi TM
Arthritis research & therapy, R71 , 2009

Abstract:

INTRODUCTION: The major risk factor for osteoarthritis (OA) is aging, but the mechanisms underlying this risk are only partly understood. Age-related accumulation of advanced glycation end products (AGEs) can activate chondrocytes and induce the production of proinflammatory cytokines and matrix metalloproteinases (MMPs). In the present study, we examined the effect of epigallocatechin-3-gallate (EGCG) on AGE-modified-BSA (AGE-BSA)-induced activation and production of TNFalpha and MMP-13 in human OA chondrocytes. METHODS: Human chondrocytes were derived from OA cartilage by enzymatic digestion and stimulated with in vitro-generated AGE-BSA. Gene expression of TNFalpha and MMP-13 was measured by quantitative RT-PCR. TNFalpha protein in culture medium was determined using cytokine-specific ELISA. Western immunoblotting was used to analyze the MMP-13 production in the culture medium, phosphorylation of mitogen-activated protein kinases (MAPKs), and the activation of NF-kappaB. DNA binding activity of NF-kappaB p65 was determined using a highly sensitive and specific ELISA. IkappaB kinase (IKK) activity was determined using an in vitro kinase activity assay. MMP-13 activity in the culture medium was assayed by gelatin zymography. RESULTS: EGCG significantly decreased AGE-stimulated gene expression and production of TNFalpha and MMP-13 in human chondrocytes. The inhibitory effect of EGCG on the AGE-BSA-induced expression of TNFalpha and MMP-13 was mediated at least in part via suppression of p38-MAPK and JNK activation. In addition, EGCG inhibited the phosphorylating activity of IKKbeta kinase in an in vitro activity assay and EGCG inhibited the AGE-mediated activation and DNA binding activity of NF-kappaB by suppressing the degradation of its inhibitory protein IkappaBalpha in the cytoplasm. CONCLUSIONS: These novel pharmacological actions of EGCG on AGE-BSA-stimulated human OA chondrocytes provide new suggestions that EGCG or EGCG-derived compounds may inhibit cartilage degradation by suppressing AGE-mediated activation and the catabolic response in human chondrocytes.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:175/AGA
EntrezGene:176/ACAN
EntrezGene:2597/GAPDH
EntrezGene:31/ACACA
EntrezGene:3815/KIT
EntrezGene:4322/MMP13
EntrezGene:5599/MAPK8
EntrezGene:6662/SOX9
EntrezGene:847/CAT

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNF ENSG00000204490 0,1
TNF ENSG00000206439 0,1
TNF ENSG00000223952 0,1
TNF ENSG00000228321 0,1
TNF ENSG00000228849 0,1
TNF ENSG00000230108 0,1
TNF ENSG00000232810 0,1
MMP13 ENSG00000137745 2,3
GAPDH ENSG00000111640 4,5
COL2A1 ENSG00000139219 6,7
COL10A1 ENSG00000123500 9,8

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 HSCHR6_MHC_SSTO:31535259-31535351
0, 1 HSCHR6_MHC_QBL:31535559-31535651
0, 1 HSCHR6_MHC_COX:31532728-31532820
0, 1 HSCHR6_MHC_APD:31556637-31556729
10 chr15:89403596-89403616
0, 1 HSCHR6_MHC_DBB:31527460-31527552
0, 1 chr6:31545316-31545408
0, 1 HSCHR6_MHC_MCF:31621625-31621717
3 chr11:102824925-102824945
5 chrX:46300113-46300137
0, 1 HSCHR6_MHC_MANN:31584803-31584895
6, 7 chr12:48390371-48393782
4 chr12:6643700-6643724
5 chr4:88128243-88128273
8, 9 chr6:116441346-116442049

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2714117.pdf AGGACGAACATCCAACCTTCCCAA
1 PMC2714117.pdf TTTGAGCCAGAAGAGGTTGAGGGT
2 PMC2714117.pdf CGCCAGAAGAATCTGTCTTTAAA
3 PMC2714117.pdf CCAAATTATGGAGGAGATGC
4 PMC2714117.pdf TCGACAGTCAGCCGCATCTTCTTT
5 PMC2714117.pdf ACCAAATCCGTTGACTCCGACCTT
6 PMC2714117.pdf ACGTGAAAGACTGCCTCAGC
7 PMC2714117.pdf TTTCATCAAATCCTCCAGCC
8 PMC2714117.pdf TGATCCTGGAGTTGGAGGAC
9 PMC2714117.pdf GAGATCGATGATGGCACTCC
10 PMC2714117.pdf GACCTGCAAGGAGACAGAGG
11 PMC2714117.pdf CCACTGGTAGTCCTTGGGCAT
12 PMC2714117.pdf GATTTTTCACGCAGCCCTAA
13 PMC2714117.pdf ATACAGTCCAGGCAGACCCA
Display recognized sequences in FASTA format