text2genome

About us

Related Links

Press Coverage

PubMed: 19578435    PubMedCentral: PMC2698121

NOD2, RIP2 and IRF5 play a critical role in the type I interferon response to Mycobacterium tuberculosis.

Pandey AK, Yang Y, Jiang Z, Fortune SM, Coulombe F, Behr MA, Fitzgerald KA, Sassetti CM, Kelliher MA
PLoS pathogens, , 2009

Abstract:

While the recognition of microbial infection often occurs at the cell surface via Toll-like receptors, the cytosol of the cell is also under surveillance for microbial products that breach the cell membrane. An important outcome of cytosolic recognition is the induction of IFNalpha and IFNbeta, which are critical mediators of immunity against both bacteria and viruses. Like many intracellular pathogens, a significant fraction of the transcriptional response to Mycobacterium tuberculosis infection depends on these type I interferons, but the recognition pathways responsible remain elusive. In this work, we demonstrate that intraphagosomal M. tuberculosis stimulates the cytosolic Nod2 pathway that responds to bacterial peptidoglycan, and this event requires membrane damage that is actively inflicted by the bacterium. Unexpectedly, this recognition triggers the expression of type I interferons in a Tbk1- and Irf5-dependent manner. This response is only partially impaired by the loss of Irf3 and therefore, differs fundamentally from those stimulated by bacterial DNA, which depend entirely on this transcription factor. This difference appears to result from the unusual peptidoglycan produced by mycobacteria, which we show is a uniquely potent agonist of the Nod2/Rip2/Irf5 pathway. Thus, the Nod2 system is specialized to recognize bacteria that actively perturb host membranes and is remarkably sensitive to mycobacteria, perhaps reflecting the strong evolutionary pressure exerted by these pathogens on the mammalian immune system.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:10392/NOD1
EntrezGene:10928/RALBP1
EntrezGene:23114/NFASC
EntrezGene:3661/IRF3
EntrezGene:3663/IRF5
EntrezGene:4615/MYD88
EntrezGene:6352/CCL5
EntrezGene:64127/NOD2
EntrezGene:7099/TLR4
EntrezGene:76044/Ncapg2
EntrezGene:80712/ESX1
EntrezGene:8767/RIPK2

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Ifnb1 ENSMUSG00000048806 1,2
Actb ENSMUSG00000029580 4,3
Tnf ENSMUSG00000024401 5,6
Ccl5 ENSMUSG00000035042 7,8

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
7, 8 chr11:83339535-83342713
3, 4 chrX:148925774-148925954
3, 4 chr5:143666931-143667111
5, 6 chr17:35337121-35338057
3, 4 chrX:148867468-148867648
0, 1, 2 chr4:88168279-88329193

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2698121.pdf TTCTGCTCTGACCACCTCCC
1 PMC2698121.pdf CGTCTCCTGGATGAACTCCAC
2 PMC2698121.pdf TGAGGACATCTCCCACGTCA
3 PMC2698121.pdf CGAGGCCCAGAGCAAGAGAG
4 PMC2698121.pdf CGGTTGGCCTTAGGGTTCAG
5 PMC2698121.pdf CAGTTCTATGGCCCAGACCCT
6 PMC2698121.pdf CGGACTCCGCAAAGTCTAAG
7 PMC2698121.pdf GCCCACGTCAAGGAGTATTTCTA
8 PMC2698121.pdf ACACACTTGGCGGTTCCTTC
Display recognized sequences in FASTA format