text2genome

About us

Related Links

Press Coverage

PubMed: 19468318    PubMedCentral: PMC2680626

Impact of methylglyoxal and high glucose co-treatment on human mononuclear cells.

Hsieh MS, Chan WH
International journal of molecular sciences, 1445 , 2009

Abstract:

Hyperglycemia and elevation of methylglyoxal (MG) are symptoms of diabetes mellitus (DM). In this report, we show that co-treatment of human mononuclear cells (HMNCs) with MG (5 microM) and high glucose (HG; 15 - 30 mM) induces apoptosis or necrosis. HG/MG co-treatment directly enhanced the reactive oxygen species (ROS) content in HMNCs, leading to decreased intracellular ATP levels, which control cell death via apoptosis or necrosis. Concentrations of 5 microM MG and 15 mM glucose significantly increased cytoplasmic free calcium and nitric oxide (NO) levels, loss of mitochondrial membrane potential (MMP), activation of caspases-9 and -3, and cell death. In contrast, no apoptotic biochemical changes were detected in HMNCs treated with 5 microM MG and 25 mM glucose, which appeared to undergo necrosis. Pretreatment with nitric oxide (NO) scavengers inhibited apoptotic biochemical changes induced by 5 microM MG/15 mM glucose, and increased the gene expression levels of p53 and p21 involved in apoptotic signaling. The results collectively suggest that the treatment dosage of MG and glucose determines the mode of cell death (apoptosis vs. necrosis) of HMNCs, and that both ROS and NO play important roles in MG/HG-induced apoptosis.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Homo sapiens
Coffea arabica
Mus musculus
Rattus norvegicus
Gallus gallus
Bos taurus
Cricetulus griseus
Genes found in fulltext (GNAT)
EntrezGene:1026/CDKN1A
EntrezGene:1604/CD55
EntrezGene:1666/DECR1
EntrezGene:22861/AC055839.1
EntrezGene:472/ATM
EntrezGene:4842/NOS1
EntrezGene:5599/MAPK8
EntrezGene:581/BAX
EntrezGene:596/BCL2
EntrezGene:6098/ROS1
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 0,1,3

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr17:7572898-7577533
2 chr6:36646505-36646527

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2680626.pdf CCCATCCTCACCATCATCAC
1 PMC2680626.pdf GTCAGTGGGGAACAAGAAGTG
2 PMC2680626.pdf GCCGAAGTCAGTTCCTTGTGGA
3 PMC2680626.pdf GACTCCAGTGGTAATCTACTT
4 PMC2680626.pdf GCGCGCTTTGTAGGATTCG
Display recognized sequences in FASTA format