text2genome

About us

Related Links

Press Coverage

PubMed: 19468068    PubMedCentral: PMC2711592

Induction of alternative lengthening of telomeres-associated PML bodies by p53/p21 requires HP1 proteins.

Jiang WQ, Zhong ZH, Nguyen A, Henson JD, Toouli CD, Braithwaite AW, Reddel RR
The Journal of cell biology, 797 , 2009

Abstract:

Alternative lengthening of telomeres (ALT) is a recombination-mediated process that maintains telomeres in telomerase-negative cancer cells. In asynchronously dividing ALT-positive cell populations, a small fraction of the cells have ALT-associated promyelocytic leukemia nuclear bodies (APBs), which contain (TTAGGG)n DNA and telomere-binding proteins. We found that restoring p53 function in ALT cells caused p21 up-regulation, growth arrest/senescence, and a large increase in cells containing APBs. Knockdown of p21 significantly reduced p53-mediated induction of APBs. Moreover, we found that heterochromatin protein 1 (HP1) is present in APBs, and knockdown of HP1alpha and/or HP1gamma prevented p53-mediated APB induction, which suggests that HP1-mediated chromatin compaction is required for APB formation. Therefore, although the presence of APBs in a cell line or tumor is an excellent qualitative marker for ALT, the association of APBs with growth arrest/senescence and with "closed" telomeric chromatin, which is likely to repress recombination, suggests there is no simple correlation between ALT activity level and the number of APBs or APB-positive cells.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:10111/RAD50
EntrezGene:1017/CDK2
EntrezGene:1026/CDKN1A
EntrezGene:4683/NBN
EntrezGene:5111/PCNA
EntrezGene:5371/PML
EntrezGene:5888/RAD51
EntrezGene:5893/RAD52
EntrezGene:5925/RB1
EntrezGene:6672/SP100
EntrezGene:672/BRCA1
EntrezGene:7013/TERF1
EntrezGene:7014/TERF2
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
CDKN1A ENSG00000124762 0,1
PCNA ENSG00000132646 3,11
CBX1 ENSG00000108468 5,6
CBX3 ENSG00000122565 7,8
TP53 ENSG00000141510 10,2
CBX5 ENSG00000094916 12,13

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
13 chr3:88144968-88144989
0, 1 chr6:36653652-36653759
7, 8 chr7:26246062-26252020
7, 8 chr11:27828087-27828776
4 chr2:231334970-231334991
5, 6 chr17:46148083-46148746
3 chr20:5099267-5099288
12 chr12:54645973-54645994
3 chr2:44139258-44139279
2, 10 chr17:7577528-7578256

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2711592.pdf CAGTTTGTGTGTCTTAATTAT
1 PMC2711592.pdf CTGGCATTAGAATTATTTAAA
2 PMC2711592.pdf AAGGAAATTTGCGTGTGGAGT
3 PMC2711592.pdf ATGGATTTAGATGTTGAACAA
4 PMC2711592.pdf CAGGAAATTATGATAAACTCA
5 PMC2711592.pdf AAGGGAAGGAGTTCTACTTGT
6 PMC2711592.pdf AAGGACTAAGCCTGTTCATAA
7 PMC2711592.pdf AAAGTACTAGATCGACGTGTA
8 PMC2711592.pdf CTGGTTACTTTGAACAAATAA
9 PMC2711592.pdf AAAATTGTGTACCTTTAGCTT
10 PMC2711592.pdf CGGCATGAACCGGAGGCCCAT
11 PMC2711592.pdf GAGGAGGAAGCTGTTACCATA
12 PMC2711592.pdf AACCTGAGAAAAACTTGGATT
13 PMC2711592.pdf GAGGAGCACAATACTTGGGAA
Display recognized sequences in FASTA format