text2genome

About us

Related Links

Press Coverage

PubMed: 17637837    PubMedCentral: PMC1905939

Primate TNF promoters reveal markers of phylogeny and evolution of innate immunity.

Baena A, Mootnick AR, Falvo JV, Tsytskova AV, Ligeiro F, Diop OM, Brieva C, Gagneux P, O'Brien SJ, Ryder OA, Goldfeld AE
PloS one, , 2007

Abstract:

BACKGROUND: Tumor necrosis factor (TNF) is a critical cytokine in the immune response whose transcriptional activation is controlled by a proximal promoter region that is highly conserved in mammals and, in particular, primates. Specific single nucleotide polymorphisms (SNPs) upstream of the proximal human TNF promoter have been identified, which are markers of human ancestry. METHODOLOGY/PRINCIPAL FINDINGS: Using a comparative genomics approach we show that certain fixed genetic differences in the TNF promoter serve as markers of primate speciation. We also demonstrate that distinct alleles of most human TNF promoter SNPs are identical to fixed nucleotides in primate TNF promoters. Furthermore, we identify fixed genetic differences within the proximal TNF promoters of Asian apes that do not occur in African ape or human TNF promoters. Strikingly, protein-DNA binding assays and gene reporter assays comparing these Asian ape TNF promoters to African ape and human TNF promoters demonstrate that, unlike the fixed differences that we define that are associated with primate phylogeny, these Asian ape-specific fixed differences impair transcription factor binding at an Sp1 site and decrease TNF transcription induced by bacterial stimulation of macrophages. CONCLUSIONS/SIGNIFICANCE: Here, we have presented the broadest interspecies comparison of a regulatory region of an innate immune response gene to date. We have characterized nucleotide positions in Asian ape TNF promoters that underlie functional changes in cell type- and stimulus-specific activation of the TNF gene. We have also identified ancestral TNF promoter nucleotide states in the primate lineage that correspond to human SNP alleles. These findings may reflect evolution of Asian and African apes under a distinct set of infectious disease pressures involving the innate immune response and TNF.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1234/CCR5
EntrezGene:21926/Tnf
EntrezGene:3133/HLA-E
EntrezGene:3133/HLA-E
EntrezGene:3133/HLA-E
EntrezGene:6548/SLC9A1
EntrezGene:6670/SP3
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:7173/TPO
EntrezGene:76044/Ncapg2

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNF ENSG00000204490 13,28
TNF ENSG00000206439 13,28
TNF ENSG00000223952 13,28
TNF ENSG00000228321 13,28
TNF ENSG00000228849 13,28
TNF ENSG00000230108 13,28
TNF ENSG00000232810 13,28

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 chr6:31542076-31543488
0, 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 HSCHR6_MHC_SSTO:31532019-31533431

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1905939.pdf AAATCCCCGCCCCCGCGATGG
1 PMC1905939.pdf CCATCGCGGGGGCGGGGATTT
2 PMC1905939.pdf AAATCCCCGCCCCCGCGATGG
3 PMC1905939.pdf CCATCGCGGGGGCGGGGATTT
4 PMC1905939.pdf AAATCCCCACCCCCGTGATGG
5 PMC1905939.pdf CCATCACGGGGGTGGGGATTT
6 PMC1905939.pdf AAATCCCCGCCCCCGTGATGG
7 PMC1905939.pdf CCATCACGGGGGCGGGGATTT
8 PMC1905939.pdf AAATCCCCGCCCTCGCGATGG
9 PMC1905939.pdf CCATCGCGAGGGCGGGGATTT
10 PMC1905939.pdf AAATCCCCACCCTCGCGATGG
11 PMC1905939.pdf CCATCGCGAGGGTGGGGATTT
12 PMC1905939.pdf AGTGAGAACTTCCCAGTCTATCTAAG
13 PMC1905939.pdf CCGTGGGTCAGTATGTGAGA
14 PMC1905939.pdf CCCAATAAACCTCTTTTCTCTGA
15 PMC1905939.pdf TTGGAAGCCAAGACTGAAACC
16 PMC1905939.pdf GTGCCAACAACTGCCTTTA
17 PMC1905939.S1.doc GGGAGCAAGAGCTGTGGGGAGAACAAAAGGATAAGGGCTCAGAGAGCTTCAGGGATATGTGATGGACTCACCAGGTGAGGCCGCCAGACTGCTGCAGGGGAAGCAAAGG
18 PMC1905939.S1.doc AGAAGCTGAGAAGATGAAGGAAAAGTCAGGGTCTGGAGGGGCGGGGGTCAGGGAGCTCCTGGGAGATATGGCCACATGTAGCGGCTCTGAGGAATGGGTTACAGGAGA
19 PMC1905939.S1.doc CCTCTGGGGAGATGTGACCACAGCAATGGGTAGGAGAATGTCCAGGGCTATGGAAGTCGAGTATGGGGACCCCCCCTTAACGAAGACAGGGCCATGTAGAGGGCCCCAGG
20 PMC1905939.S1.doc GAGTGAAAGAGCCTCCAGGACCTCCAGGTATGGAATACAGGGGACGTTTAAGAAGATATGGCCACACACTGGGGCCCTGAGAAGTGAGAGCTTCATGAAAAAAATCA
21 PMC1905939.S1.doc GGGACCCCAGAGTTCCTTGGAAGCCAAGACTGAAACCAGCATTATGAGTCTCCGGGTCAGAATGAAAGAAGAAGGCCTGCCCCAGTGGGGTCTGTGAATTCCCGGGGGTG
22 PMC1905939.S1.doc ATTTCACTCCCCGGGGCTGTCCCAGGCTTGTCCCTGCTACCCCCACCCAGCCTTTCCTGAGGCCTCAAGCCTGCCACCAAGCCCCCAGCTCCTT
23 PMC1905939.S1.doc CTCCCCGCAGGGACCCAAACACAGGCCTCAGGACTCAACACAGCTTTTCCCTCCAACCCCGTTTTCTCTCCCTCAAGGACTCAGCTTTCTGAAGCCCCTCCCAGTTCT
24 PMC1905939.S1.doc AGTTCTATCTTTTTCCTGCATCCTGTCTGGAAGTTAGAAGGAAACAGACCACAGACCTGGTCCCCAAAAGAAATGGAGGCAATAGGTTTTGAGGGGCATGGGGACGGGG
25 PMC1905939.S1.doc TTCAGCCTCCAGGGTCCTACACACAAATCAGTCAGTGGCCCAGAAGACCCCCCTCGGAATCGGAGCAGGGAGGATGGGGAGTGTGAGGGGTATCCTTGATGCTTGTGTG
26 PMC1905939.S1.doc TCCCCAACTTTCCAAATCCCCGCCCCCGCGATGGAGAAGAAACCGAGACAGAAGGTGCAGGGCCCACTACCGCTTCCTCCAGATGAGCTCATGGGTTTCTCCACCAAGGA
27 PMC1905939.S1.doc AGTTTTCCGCTGGTTGAATGATTCTTTCCCCGCCCTCCTCTCGCCCCAGGGACATATAAAGGCAGTTGTTGGCACACCCAGCCAGCAGACGCTCCCTCAGCAAGGACAG
28 PMC1905939.S1.doc CAGAGGACCAGCTAAGAGGGAGAGAAGCAACTACAGACC
29 PMC1905939.S2.pdf CTGGAGCTGCCCTGTATGGAGCTGCCCTGTCTACAGACCTCTCTCGGAGCAGCTTCCTTTCTCTACTCTCTCTTCGACTGCGAGATCCTCCTCTGA
Display recognized sequences in FASTA format