text2genome

About us

Related Links

Press Coverage

PubMed: 17081288    PubMedCentral: PMC1636066

SMC3 knockdown triggers genomic instability and p53-dependent apoptosis in human and zebrafish cells.

Ghiselli G
Molecular cancer, 52 , 2006

Abstract:

BACKGROUND: The structural maintenance of chromosome 3 (SMC3) protein is a constituent of a number of nuclear multimeric protein complexes that are involved in DNA recombination and repair in addition to chromosomal segregation. Overexpression of SMC3 activates a tumorigenic cascade through which mammalian cells acquire a transformed phenotype. This has led us to examine in depth how SMC3 level affects cell growth and genomic stability. In this paper the effect of SMC3 knockdown has been investigated. RESULTS: Mammalian cells that are SMC3 deficient fail to expand in a clonal population. In order to shed light on the underlying mechanism, experiments were conducted in zebrafish embryos in which cell competence to undergo apoptosis is acquired at specific stages of development and affects tissue morphogenesis. Zebrafish Smc3 is 95% identical to the human protein, is maternally contributed, and is expressed ubiquitously at all developmental stages. Antisense-mediated loss of Smc3 function leads to increased apoptosis in Smc3 expressing cells of the developing tail and notocord causing morphological malformations. The apoptosis and the ensuing phenotype can be suppressed by injection of a p53-specific MO that blocks the generation of endogenous p53 protein. Results in human cells constitutively lacking p53 or BAX, confirmed that a p53-dependent pathway mediates apoptosis in SMC3-deficient cells. A population of aneuploid cells accumulated in zebrafish embryos following Smc3-knockdown whereas in human cells the transient downregulation of SMC3 level lead to the generation of cells with amplified centrosome number. CONCLUSION: Smc3 is required for normal embryonic development. Its deficiency affects the morphogenesis of tissues with high mitotic index by triggering an apoptotic cascade involving p53 and the downstream p53 target gene bax. Cells with low SMC3 level display centrosome abnormalities that can lead to or are the consequence of dysfunctional mitosis and/or aneuploidy. Collectively the data support the view that SMC3 deficiency affects chromosomal stability leading to the activation of p53-dependent mitotic checkpoint.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:30222/ccnd1
EntrezGene:30222/ccnd1
EntrezGene:30590/tp53
EntrezGene:30637/mdm2
EntrezGene:58081/baxa
EntrezGene:322275/rad21
EntrezGene:324475/smc3
EntrezGene:9126/SMC3
Genes found in fulltext (GNAT)
EntrezGene:1026/CDKN1A
EntrezGene:10735/STAG2
EntrezGene:133396/IL31RA
EntrezGene:1791/DNTT
EntrezGene:22059/Trp53
EntrezGene:24842/P53_RAT
EntrezGene:29486/SMC3_RAT
EntrezGene:30590/tp53
EntrezGene:30637/mdm2
EntrezGene:321836/krit1
EntrezGene:324475/smc3
EntrezGene:3815/KIT
EntrezGene:4193/MDM2
EntrezGene:445390/mybl2
EntrezGene:4605/MYBL2
EntrezGene:4683/NBN
EntrezGene:581/BAX
EntrezGene:5885/RAD21
EntrezGene:672/BRCA1
EntrezGene:675/BRCA2
EntrezGene:7157/TP53
EntrezGene:8243/SMC1A
EntrezGene:853371/SMC3
EntrezGene:9126/SMC3
EntrezGene:9232/PTTG1
EntrezGene:9371/KIF3B
EntrezGene:9700/ESPL1

Best predicted genome from sequences: Danio rerio

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
smc3 ENSDARG00000019000 0,1,2,5,6
rad21 ENSDARG00000006092 9,10
wu:fc17g12 ENSDARG00000053668 11,12
tp53 ENSDARG00000035559 13,14
mdm2 ENSDARG00000033443 15,16
ccnd1 ENSDARG00000035750 19,20
ccnd1 ENSDARG00000078048 19,20
baxa ENSDARG00000020623 21,22

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
20 chr7:55228970-55228990
0, 1, 2, 5, 6 chr22:32396587-32443819
11, 12 chr14:29826028-29827816
9, 10 chr16:44153048-44154208
20 chr7:55318287-55318307
15, 16 chr4:22922061-22929135
21, 22 chr3:34896941-34900655
17, 18 chr22:364437-364836
13, 14 chr5:22119865-22126564
8 chr23:28149321-28149348

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1636066.pdf GCATAAACCGCCATGTACATTAAA
1 PMC1636066.pdf TGTGTTTTTCTCTTAGCCGTGAGT
2 PMC1636066.pdf GTACATGGCGGTTTATGCACAAAAC
3 PMC1636066.pdf CTCCTCAGAAACCAAATAAATAAAG
4 PMC1636066.pdf GTACtTGGCcGTTTtTGCAgAAAAC
5 PMC1636066.S1.doc CTCTGGATCAGGCCATCAATGACA
6 PMC1636066.S1.doc CAGACTGGCTTCCAGACTCTGAAG
7 PMC1636066.S1.doc CTCTCTGAACAATCAGACAGTATGGCA
8 PMC1636066.S1.doc TTTCCTCAAACAAAGCTGTCCTCTCTT
9 PMC1636066.S1.doc GCAATGTTTTACGCCCACTTCGT
10 PMC1636066.S1.doc TTCCTACTTCCTCCCTCATGGTG
11 PMC1636066.S1.doc CATGCTTTTTGAAGTGGTCAGGCT
12 PMC1636066.S1.doc CCAATCATCTTGTTTCTCTCTGCT
13 PMC1636066.S1.doc TGTCAGCTGGCAAAAACTTG
14 PMC1636066.S1.doc ACAAAGGTCCCAGTGGAGTG
15 PMC1636066.S1.doc CAGCAAGGTTGACAACGAGA
16 PMC1636066.S1.doc CGAAGGTTGTGTTGGGAGTT
17 PMC1636066.S1.doc TGAGAACTTACTGGCAGCTTCA
18 PMC1636066.S1.doc AGCTGCATTCGTCTCGTAGC
19 PMC1636066.S1.doc CTGACTGTCTGCGATCGTGT
20 PMC1636066.S1.doc GGGGAGCAGGTACAACGTAA
21 PMC1636066.S1.doc GCAGTGGCAATGACCAGATA
22 PMC1636066.S1.doc GGAAAACTCCGACTGTCTGC
Display recognized sequences in FASTA format