text2genome

About us

Related Links

Press Coverage

PubMed: 19484123    PubMedCentral: PMC2684588

REUL is a novel E3 ubiquitin ligase and stimulator of retinoic-acid-inducible gene-I.

Gao D, Yang YK, Wang RP, Zhou X, Diao FC, Li MD, Zhai ZH, Jiang ZF, Chen DY
PloS one, , 2009

Abstract:

RIG-I and MDA5 are cytoplasmic sensors that recognize different species of viral RNAs, leads to activation of the transcription factors IRF3 and NF-kappaB, which collaborate to induce type I interferons. In this study, we identified REUL, a RING-finger protein, as a specific RIG-I-interacting protein. REUL was associated with RIG-I, but not MDA5, through its PRY and SPRY domains. Overexpression of REUL potently potentiated RIG-I-, but not MDA5-mediated downstream signalling and antiviral activity. In contrast, the RING domain deletion mutant of REUL suppressed Sendai virus (SV)-induced, but not cytoplasmic polyI:C-induced activation of IFN-beta promoter. Knockdown of endogenous REUL by RNAi inhibited SV-triggered IFN-beta expression, and also increased VSV replication. Full-length RIG-I, but not the CARD domain deletion mutant of RIG-I, underwent ubiquitination induced by REUL. The Lys 154, 164, and 172 residues of the RIG-I CARD domain were critical for efficient REUL-mediated ubiquitination, as well as the ability of RIG-I to induce activation of IFN-beta promoter. These findings suggest that REUL is an E3 ubiquitin ligase of RIG-I and specifically stimulates RIG-I-mediated innate antiviral activity.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:23586/DDX58
EntrezGene:84282/RNF135
Genes found in fulltext (GNAT)
EntrezGene:230073/Ddx58
EntrezGene:23586/DDX58
EntrezGene:3661/IRF3
EntrezGene:3665/IRF7
EntrezGene:54941/RNF125
EntrezGene:56745/C1qtnf1
EntrezGene:57120/GOPC
EntrezGene:57506/MAVS
EntrezGene:6352/CCL5
EntrezGene:64135/IFIH1
EntrezGene:7098/TLR3
EntrezGene:7099/TLR4
EntrezGene:7322/UBE2D2
EntrezGene:7706/TRIM25
EntrezGene:9140/ATG12
EntrezGene:9978/RBX1

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNF ENSG00000204490 0,1
TNF ENSG00000206439 0,1
TNF ENSG00000223952 0,1
TNF ENSG00000228321 0,1
TNF ENSG00000228849 0,1
TNF ENSG00000230108 0,1
TNF ENSG00000232810 0,1
ACTB ENSG00000075624 2,3
IFNB1 ENSG00000171855 6,7
ISG15 ENSG00000187608 8,9
CCL5 ENSG00000161570 10,11

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3 chr7:5567342-5567762
0, 1 HSCHR6_MHC_MANN:31584664-31584961
0, 1 HSCHR6_MHC_COX:31532589-31532886
4 chr17:29311689-29325877
5 chr20:3835300-3835319
0, 1 HSCHR6_MHC_SSTO:31535120-31535417
6, 7 chr9:21077557-21077864
0, 1 chr6:31545177-31545474
0, 1 HSCHR6_MHC_APD:31556498-31556795
10, 11 chr17:34199405-34207289
0, 1 HSCHR6_MHC_QBL:31535420-31535717
0, 1 HSCHR6_MHC_DBB:31527321-31527618
8, 9 chr1:949364-949609
0, 1 HSCHR6_MHC_MCF:31621486-31621783

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2684588.pdf CCTGGTATGAGCCCATCTATC
1 PMC2684588.pdf CGAAGTGGTGGTCTTGTTGC
2 PMC2684588.pdf ACGTGGACATCCGCAAAGAC
3 PMC2684588.pdf CAAGAAAGGGTGTAACGCAACTA
4 PMC2684588.pdf AACATCTTGTAGACATTGTCAAATCAGAGATATTCTCCATGAAAGTGAAGTGGACACTAGGAATTGCA
5 PMC2684588.pdf GTATATCTGCCGCAATTTC
6 PMC2684588.pdf CCAACAAGTGTCTCCTCCAA
7 PMC2684588.pdf ATAGTCTCATTCCAGCCAGT
8 PMC2684588.pdf GCTGGGACCTGACGGTGAAGA
9 PMC2684588.pdf GCTCAGAGGTTCGTCGCATTTGT
10 PMC2684588.pdf CCTCGCTGTCATCCTCATTG
11 PMC2684588.pdf TACTCCCGAACCCATTTCTT
Display recognized sequences in FASTA format