text2genome

About us

Related Links

Press Coverage

PubMed: 11812858    PubMedCentral: PMC97629

Genotyping by apyrase-mediated allele-specific extension.

Ahmadian A, Gharizadeh B, O'Meara D, Odeberg J, Lundeberg J
Nucleic acids research, e121 , 2001

Abstract:

This report describes a single-step extension approach suitable for high-throughput single-nucleotide polymorphism typing applications. The method relies on extension of paired allele-specific primers and we demonstrate that the reaction kinetics were slower for mismatched configurations compared with matched configurations. In our approach we employ apyrase, a nucleotide degrading enzyme, to allow accurate discrimination between matched and mismatched primer-template configurations. This apyrase-mediated allele-specific extension (AMASE) protocol allows incorporation of nucleotides when the reaction kinetics are fast (matched 3'-end primer) but degrades the nucleotides before extension when the reaction kinetics are slow (mismatched 3'-end primer). Thus, AMASE circumvents the major limitation of previous allele-specific extension assays in which slow reaction kinetics will still give rise to extension products from mismatched 3'-end primers, hindering proper discrimination. It thus represents a significant improvement of the allele-extension method. AMASE was evaluated by a bioluminometric assay in which successful incorporation of unmodified nucleotides is monitored in real-time using an enzymatic cascade.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:124583/CANT1
EntrezGene:3690/ITGB3
EntrezGene:4524/MTHFR
EntrezGene:4594/MUT
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 1,6
MTHFR ENSG00000177000 2,3,7

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
8 chr17:45360707-45360727
2, 3, 7 chr1:11856355-11856378

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC97629.pdf GCTGCTGGTGCAGGGGCCACGC
1 PMC97629.pdf GCTGCTGGTGCAGGGGCCACGG
2 PMC97629.pdf GCTGCGTGATGATGAAATCGA
3 PMC97629.pdf GCTGCGTGATGATGAAATCGG
4 PMC97629.pdf TCTTACAGGCCCTGCCTCC
5 PMC97629.pdf TCTTACAGGCCCTGCCTCT
6 PMC97629.pdf GCTGCTGGTGCAGGGGCCA
7 PMC97629.pdf AAGCTGCGTGATGATGAAA
8 PMC97629.pdf CCTGTCTTACAGGCCCTGCC
Display recognized sequences in FASTA format