text2genome

About us

Related Links

Press Coverage

PubMed: 18288268    PubMedCentral: PMC2233768

Effects of a combination of thyme and oregano essential oils on TNBS-induced colitis in mice.

Bukovská A, Cikos S, Juhás S, Il'ková G, Rehák P, Koppel J
Mediators of inflammation, , 2007

Abstract:

We examined the anti-inflammatory effects of the combination of thyme and oregano essential oil dietary administered at three concentrations (0.4% thyme and 0.2% oregano oils; 0.2% thyme and 0.1% oregano oils; 0.1% thyme and 0.05% oregano oils) on mice with TNBS-induced colitis. Treatment of colitic animals with the essential oils decreased the mRNA levels of pro-inflammatory cytokines IL-1beta, IL-6, GM-CSF, and TNFalpha, especially after application of the medium dose. The medium dose of the essential oils significantly lowered the amount of IL-1beta and IL-6 proteins too. Moreover, administration of the medium dose decreased the mortality rate, accelerated the body weight gain recovery, and reduced the macroscopic damage of the colonic tissue. Our results indicate that combined treatment with appropriate concentrations of thyme and oregano essential oils can reduce the production of proinflammatory cytokines, and thereby attenuate TNBS-induced colitis in mice.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Thymus vulgaris
Origanum vulgare
Mus sp.
Homo sapiens
Mus musculus
Rattus norvegicus
Mentha x piperita
Camellia sinensis
Vicia sativa
Curcuma longa
Comarum palustre
Ginkgo biloba
Escherichia coli
Lateolabrax japonicus
Cavia porcellus
Penicillium expansum
Meleagris gallopavo
Gallus gallus
Genes found in fulltext (GNAT)
EntrezGene:12981/Csf2
EntrezGene:1437/CSF2
EntrezGene:16193/Il6
EntrezGene:3251/HPRT1
EntrezGene:3569/IL6
EntrezGene:3576/IL8
EntrezGene:3586/IL10
EntrezGene:3593/IL12B
EntrezGene:9337/CNOT8

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Il1b ENSMUSG00000027398 0,1
Il6 ENSMUSG00000025746 2,3
Il10 ENSMUSG00000016529 4,5
Tnf ENSMUSG00000024401 6,7
Csf2 ENSMUSG00000018916 8,9
Ifng ENSMUSG00000055170 10,11
Actb ENSMUSG00000029580 12,13
Hprt1 ENSMUSG00000025630 14,15
Sdha ENSMUSG00000021577 16,17

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
12, 13 chr16:37883217-37883398
12, 13 chr5:143666024-143666205
7 chr17:35337366-35337390
4, 5 chr1:132917560-132918038
2, 3 chr5:30340073-30344657
10, 11 chr10:117879741-117882318
16, 17 chr13:74460536-74464395
15 chrX:50374282-50374304
8, 9 chr11:54061026-54062013
1 chr2:129190942-129190964

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2233768.pdf AAGTGATATTCTCCATGAGCTTTGT
1 PMC2233768.pdf TTCTTCTTTGGGTATTGCTTGG
2 PMC2233768.pdf TGGGAAATCGTGGAAATGAG
3 PMC2233768.pdf CTCTGAAGGACTCTGGCTTTG
4 PMC2233768.pdf CAACATACTGCTAACCGACTCCT
5 PMC2233768.pdf TGAGGGTCTTCAGCTTCTCAC
6 PMC2233768.pdf CGTCGTAGCAAACCACCAAG
7 PMC2233768.pdf TTGAAGAGAACCTGGGAGTAGACA
8 PMC2233768.pdf GCAATTTCACCAAACTCAAGG
9 PMC2233768.pdf CTCATTACGCAGGCACAAAAG
10 PMC2233768.pdf ATCAGGCCATCAGCAACAAC
11 PMC2233768.pdf ATCAGCAGCGACTCCTTTTC
12 PMC2233768.pdf AAATCGTGCGTGACATCAAAG
13 PMC2233768.pdf AAGAAGGAAGGCTGGAAAAGAG
14 PMC2233768.pdf TGGATACAGGCCAGACTTTGTT
15 PMC2233768.pdf ACTTGCGCTCATCTTAGGCTTT
16 PMC2233768.pdf CATGCCAGGGAAGATTACAAAG
17 PMC2233768.pdf AGTAGGAGCGGATAGCAGGAGTacC
Display recognized sequences in FASTA format