text2genome

About us

Related Links

Press Coverage

PubMed: 19759900    PubMedCentral: PMC2738961

Pertussis toxin stimulates IL-17 production in response to Bordetella pertussis infection in mice.

Andreasen C, Powell DA, Carbonetti NH
PloS one, , 2009

Abstract:

In a mouse model of respiratory tract infection by Bordetella pertussis, bacteria multiply in the airways over the first week and are then cleared over the next 3-4 weeks by the host immune response. Pertussis toxin (PT), a virulence factor secreted exclusively by B. pertussis, promotes bacterial growth in the airways by suppression and modulation of host immune responses. By comparison of wild type and PT-deficient strains, we examined the role of PT in modulating airway cytokine and chemokine responses affecting neutrophil recruitment during B. pertussis infection in mice. We found that, despite early inhibition of neutrophil recruitment by PT, high numbers of neutrophils were recruited to the airways by 4 days post-infection with the wild type strain, but not with the PT-deficient strain, and that this correlated with upregulation of neutrophil-attracting chemokine gene expression. In addition, there was similar upregulation of genes expressing the cytokines IL-17A (IL-17), TNF-alpha and IFN-gamma, indicating a mixed Th1/Th17 response. Expression of IL-6, a cytokine involved in Th17 induction, was upregulated earlier than the IL-17 response. We showed that PT, rather than bacterial numbers, was important for induction of these responses. Flow cytometric analysis revealed that the IL-17-producing cells were macrophages and neutrophils as well as T cells, and were present predominantly in the airways rather than the lung tissue. Antibody neutralization of IL-17 significantly reduced chemokine gene expression and neutrophil recruitment to the airways, but only modestly increased peak bacterial loads. These data indicate that PT stimulates inflammatory responses by induction of Th1- and Th17-associated cytokines, including IL-17, during B. pertussis infection in mice, but a role for IL-17 in protection against the infection remains to be established.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:16171/Il17a
Genes found in fulltext (GNAT)
EntrezGene:12/SERPINA3
EntrezGene:16171/Il17a
EntrezGene:16193/Il6
EntrezGene:20311/Cxcl5
EntrezGene:21898/Tlr4
EntrezGene:21926/Tnf
EntrezGene:3569/IL6
EntrezGene:3576/IL8
EntrezGene:3586/IL10
EntrezGene:3605/IL17A
EntrezGene:51561/IL23A
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Hprt1 ENSMUSG00000025630 0,1
Cxcl1 ENSMUSG00000029380 2,3
Cxcl5 ENSMUSG00000029371 4,5
Cxcl2 ENSMUSG00000058427 6,7
Il17a ENSMUSG00000025929 8,9
Il6 ENSMUSG00000025746 10,11
Tnf ENSMUSG00000024401 12,13

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 6, 7 chr5:91320570-91333179
4, 5, 6 chr5:91188712-91215276
14 chr10:117878272-117878292
8 chr1:20722354-20722374
0 chrX:50355355-50355378
10 chr5:30340027-30340053

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2738961.pdf GCTGACCTGCTGGATTACATTAA
1 PMC2738961.pdf TGATCATTACAGTAGCTCTTCAGTCTGA
2 PMC2738961.pdf GCTTGAAGGTGTTGCCCTCA
3 PMC2738961.pdf GTGGCTATGACTTCGGTTTGG
4 PMC2738961.pdf AGCTGCCCCTTCCTCAGTC
5 PMC2738961.pdf TCCACCTCCAAATTAGCGATCAAT
6 PMC2738961.pdf ACCAACCACCAGGCTACAGG
7 PMC2738961.pdf CAGGCATTGACAGCGCAGT
8 PMC2738961.pdf ACCTCAACCGTTCCACGTCA
9 PMC2738961.pdf CAGGGTCTTCATTGCGGTG
10 PMC2738961.pdf TGTCTATACCACTTCACAAGTCGGAG
11 PMC2738961.pdf GCACAACTCTTTTCTCATTTCCAC
12 PMC2738961.pdf GACCCTCACACTCAGATCATCTTCT
13 PMC2738961.pdf CCACTTGGTGGTTTGCTACGA
14 PMC2738961.pdf CTGCCACGGCACAGTCATTG
15 PMC2738961.pdf TGCATCCTTTTTCGCCTTGCA
Display recognized sequences in FASTA format