text2genome

About us

Related Links

Press Coverage

PubMed: 20089147    PubMedCentral: PMC2819998

Down-regulation of Toll-like receptor 4 gene expression by short interfering RNA attenuates bone cancer pain in a rat model.

Lan LS, Ping YJ, Na WL, Miao J, Cheng QQ, Ni MZ, Lei L, Fang LC, Guang RC, Jin Z, Wei L
Molecular pain, 2 , 2010

Abstract:

BACKGROUND: This study demonstrates a critical role in CNS innate immunity of the microglial Toll-like receptor 4 (TLR4) in the induction and maintenance of behavioral hypersensitivity in a rat model of bone cancer pain with the technique of RNA interference (RNAi). We hypothesized that after intramedullary injection of Walker 256 cells (a breast cancer cell line) into the tibia, CNS neuroimmune activation and subsequent cytokine expression are triggered by the stimulation of microglial membrane-bound TLR4. RESULTS: We assessed tactile allodynia and spontaneous pain in female Sprague-Dawley (SD) rats after intramedullary injection of Walker 256 cells into the tibia. In a complementary study, TLR4 small interfering RNA(siRNA) was administered intrathecally to bone cancer pain rats to reduce the expression of spinal TLR4. The bone cancer pain rats treated with TLR4 siRNA displayed significantly attenuated behavioral hypersensitivity and decreased expression of spinal microglial markers and proinflammatory cytokines compared with controls. Only intrathecal injection of TRL4 siRNA at post-inoculation day 4 could prevent initial development of bone cancer pain; intrathecal injection of TRL4 siRNA at post-inoculation day 9 could attenuate, but not completely block, well-established bone cancer pain. CONCLUSIONS: TLR4 might be the main mediator in the induction of bone cancer pain. Further study of this early, specific, and innate CNS/microglial response, and how it leads to sustained glial/neuronal hypersensitivity, might lead to new therapies for the prevention and treatment of bone cancer pain syndromes.

Organism/Genes in external databases

Datasource Data

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TLR4_RAT ENSRNOG00000010522 0,4,5
ACTB_RAT ENSRNOG00000034254 2,19
IL6_RAT ENSRNOG00000010278 6,7
IL1B_RAT ENSRNOG00000004649 8,9
TNFA_RAT ENSRNOG00000000837 10,11
IFNB_RAT ENSRNOG00000006268 12,13

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
1 chr11:55993237-55993268
12, 13 chr5:107838005-107838053
16, 17 chr18:29375632-29375674
2, 19 chr12:12047083-12048317
6, 7 chr4:457132-457226
10, 11 chr20:3661050-3661094
0, 4, 5 chr5:83574944-83576713
8 chr3:116970138-116970158

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2819998.pdf TTCTCCGAACGTGTCACGTTTCCTTGGTACTGACAGGAAATTGCTTATATCCTTAAAGAAATTGGATCTTTCTAAATGCCAATTCGAGCTGGTAAAGAATTTATT
1 PMC2819998.pdf ACGTGACACGTTCGGAGAATTTTTCCTGTCAGTACCAAGGTTTTTCTTTAAGGATATAAGCTGTTGGCATTTAGAAAGATCCAGTAAATTCTTTACCAGCTCGTT
2 PMC2819998.pdf CACCCGCGAGTACAACCTTC
3 PMC2819998.pdf TCCTACCCCCAATGTGTCCGTCGTG
4 PMC2819998.pdf AGCTTTGGTCAGTTGGCTCT
5 PMC2819998.pdf AACAGCAACCTCTAAAGCTCATGGCA
6 PMC2819998.pdf AAGGACCAAGACCATCCAAC
7 PMC2819998.pdf TCGGCAAACCTAGTGTGCTATGCC
8 PMC2819998.pdf GCAACTGTCCCTGAACTCAA
9 PMC2819998.pdf TCATTCTCCTCACTGTCGAAAGCTGC
10 PMC2819998.pdf CTAACTCCCAGAAAAGCAAGCAA
11 PMC2819998.pdf CAGCCAGGCAGGTTCCGTCC
12 PMC2819998.pdf CAGCTGAATGGAAGGCTCAAC
13 PMC2819998.pdf CAGCTACAGGACGGACTTCAAGATC
14 PMC2819998.pdf GCCTCCAAGTCCGCAAGAA
15 PMC2819998.pdf ACCAAGGACAGGCTGCGAGAAGGA
16 PMC2819998.pdf CGGGAACTGACTCTTGAAAACC
17 PMC2819998.pdf CGAGGTAACCGGCACCGCG
18 PMC2819998.pdf CATCCAGAAGCGGCGAAATCATAAGTGACAGTGCTCTGGATGTCGGGTGCATCACCTCCATACCTCGGGCCAGTGTATGAGAACCACAGTGAGGAATGTCCATGTCAGCCTCAAAGAACAGGCAGGATGACACCATTGAAGC
19 PMC2819998.pdf CCCATACCCACCATCACACC
Display recognized sequences in FASTA format