text2genome

About us

Related Links

Press Coverage

PubMed: 18786271    PubMedCentral: PMC2566321

A map of the class III region of the sheep major histocompatibilty complex.

Qin J, Mamotte C, Cockett NE, Wetherall JD, Groth DM
BMC genomics, 409 , 2008

Abstract:

BACKGROUND: The central, or class III, region of the major histocompatibility complex (MHC) is an important gene rich sub-region of the MHC of mammals and contains many loci implicated in disease processes and potential productivity traits. As a prelude to identifying MHC loci associated with productivity traits in sheep, we have used BAC and cosmid libraries of genomic DNA to generate a physical map of the sheep MHC class III region. This map will facilitate association studies and provide insights into the distribution of recombination events in this chromosomal segment. RESULTS: Twenty eight sheep genes were identified in 10 BAC clones which spanned approximately 700 kbp of a chromosomal region adjacent to the class I region of the sheep MHC and which therefore covers most, if not all, of the class III of the sheep MHC. The relative positions of 17 of these genes was established as well as two additional groups of genes for which the intragroup order was not known. Cosmid mapping permitted a more detailed mapping of the complement genes present in the class III and showed a local inversion (relative to humans) of one pair of the duplicated complement C4 and CYP21 loci. A panel of 26 single nucleotide polymorphisms (SNPs) was identified in 10 loci, covering approximately 600 kbp of the mapped region. CONCLUSION: This report provides a physical map covering approximately 700 kbp of the class III of the sheep MHC together with a SNP panel which will facilitate disease and productivity association studies. The presence of a local inversion (relative to humans) of one pair of the duplicated C4 and CYP21 loci and a previously described dinucleotide tandem repeat locus (BfMs) has been located within an intron of the SK12VL gene.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1589/CYP21A2
EntrezGene:1589/CYP21A2
EntrezGene:1589/CYP21A2
EntrezGene:1589/CYP21A2
EntrezGene:18132/Notch4
EntrezGene:3133/HLA-E
EntrezGene:3133/HLA-E
EntrezGene:3133/HLA-E
EntrezGene:3815/KIT
EntrezGene:4855/NOTCH4
EntrezGene:4855/NOTCH4
EntrezGene:629/CFB
EntrezGene:629/CFB
EntrezGene:629/CFB
EntrezGene:629/CFB
EntrezGene:629/CFB
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7148/TNXB
EntrezGene:7148/TNXB
EntrezGene:7148/TNXB

Best predicted genome from sequences: Bos taurus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Q0V8E0_BOVIN ENSBTAG00000019685 7,17,26,27
TNFA_BOVIN ENSBTAG00000025471 14,23,39
Q3KUS2_BOVIN ENSBTAG00000005676 20,21

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
22 chr23:27011065-27011300
33 chr23:27749406-27773817
1, 30, 31 chr23:27312830-27475043
18, 20, 21 chr23:27215370-27259153
19 chr23:27396873-27397040
14, 23, 39 chr23:27531263-27531380
7, 17, 26, 27 chr23:27451486-27451668

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2566321.pdf GGTGGGTAGATTAGGGAGTCAGCGAGGAATACTTCTTTCCGTTTGAGCACCTTCTCTCTGGACCCAGAAAGTGAAGATGTGTTCCCTACCCCACAGATCCTAGAAGAGGGAGAAAAGCTTTTCCAAACCAAGACACTTGGAGCCTCCTAAGATTTGTCGTCCTGAGCAAATCAGTCATTTGCAAAGAGTTCACACAACTTGTGAGGGTGGTGATAAATACCATCACCACAACAAAGATGAGCGGAGGTTCAGTGAT
1 PMC2566321.pdf CACACTGGCTATGTTGACACGCTGAGCAAGCTCATAAAATATGGTGAGGGTTAAATTGGACAGAAGGATGGAGTGAGTGCTGGGCCATTGTAGTTTTACGGATCCTTGAGTCTAGTGGATAGAAGATGCTGCTGTTTCAAACACAATCACAAGACAGCAACCTCTGATGATGAAACTGGCAGGTGACAGCTCTAAGCAGATGCTCTGGGAGATAGATGGGACCTTGAAGGAGTCAAATGGGTTCTTACCGGAATACTT
2 PMC2566321.pdf GCCAGCTCATAAACAGCAAGCTCCAAGCCCTATCCCTGCTCCAGCCAAGGGCCTGCTTGGGGACAGGGGGTACCCTCACTCCATGACTCTCTCACTCACCATTCTGAGCTTTCTGCAGTGCACGGTGAGCAGCTGGACTCAGCTAGCAAGCTGCTGCCCTGGGCGGCCTATCTGCTCTCCCCTGCAGAGCGGAGGGCTATCCTGCTCAAGGAGTTGAGCTGACCTACATTCAGGTGGGAGAGGTATATACTGCCTTCTCCTCCTGAATTTACTGTGTCCCAGGTAGGGAGGGTATATATTTTAGAAATGAAGAATAGTATGCAATGCTAGCAGGTTAAAGGACAAAATTACTGGAATGTTCCTTCTGCTCCAAGTTGGTCCATGGTACGGTGCCAGGAGCTCCCAGCTCTACCTGTCTTCTCAGAACCGAAGAAATCGAGAGCAGAGCCTGCCTCCTTTTAGCTTATGTTTTCTTCCTGCCAAGTGTTTCCAGACTGCCATCAAAGAGCCCTTGCCGGGGGGACTCAGTATGCCAATGGCCTGGACAACTGGGCCACCAA
3 PMC2566321.S1.doc ggtattcttgaaagagaccagc
4 PMC2566321.S1.doc cagggtcctccaggatcaaGc
5 PMC2566321.S1.doc ccatgctctccccaacaat
6 PMC2566321.S1.doc GTTATCACCTGGTGGAACG
7 PMC2566321.S1.doc GGAAGATTGAAGGTTCCAAC
8 PMC2566321.S1.doc TTCATAGCTCTTTGGGGGACA
9 PMC2566321.S1.doc CCATCTCCCTCAAGTCTCG
10 PMC2566321.S1.doc ACAGTCCTGGCAAGAGCAG
11 PMC2566321.S1.doc CCCATCATTGCAATCAAGTGG
12 PMC2566321.S1.doc TATGAGGGACAGAACTGCTCA
13 PMC2566321.S1.doc CTGTGTGCCAGGCAGACACT
14 PMC2566321.S1.doc ACTTTATTTCTCGCCACTG
15 PMC2566321.S1.doc GCTCACCTGCTGTCACTGTC
16 PMC2566321.S1.doc AGTCAGAACTCGAGGTTCATGT
17 PMC2566321.S2.doc GGAAGATTGAAGGTTCCAACCACGACATAGCTGTTGGCATTCCGGTCATGAACAGAGGCCCCAGGCCCCGAGTACCAGGCGTGGGTCCCCCACCATGGGTGCTGAGGTGGACCCTGTTCCAGAAGATGCTCCGGAAGGGAGCTGAGTCTGAGGAGGAGCCCGTTCCACCAGGTGAATAACA
18 PMC2566321.S2.doc GGAATTCACTAGTGATTAGTCAGAACTCGAGGTTCATGTATGTCCGCAGATCCCGTCCCAGGCCTTGTCCTTCTCTTCCTGCCTTTTCTCCTCCCTGCGGTTCAGTGTGGTCACCCTAGGGGCTCTCTCCCTCCCAGCCACTGCCCGTATATCCCGAGCTGGGAAACGTGTAACTCGGGGCTGAGGTGCTGGTCTGTAGCCTAACCCCTCCTGGTCCCTCTTGAGGACAGTGGGGATAGGGTTGGCACGGCCCTCACCCCGGGGTCCTAGCCCATTCCAGGCTCCCAGCCCCCCTCAGCAGCAGCTTGACATCAGAGGTCCTCCAGGATCAAGGGGACCAATGATCCCACCACTGCTGAGTCTCCCACCTCCTCCCCGGGGCAGAGGCCCAATTCGGGGAGGCCTAGGCCCCAGGTCTGGCCCATATGGTCGTGGTTGGTGGGGGGTCAATGCCGAGCCTCCTTTCCCTGGACCAGGCCACGGGGGTCCTTCCAGGGGAGGCTTTCACAAAGAACAGAGAAATCCTCGAAGGCTCAAAAGCTGGTCTCTTGTCAAGAATACCACCCTGGAAACAAAGTAGCAGATTAGGCTGGACCAGGGCTCCTGAAGGGGCCAGAGGCTGGGAACAAGGGGTGGGAGCTCTGCCCAGGGGATCGGGAATCTGGTGCGGGCCCTTCCTTACCCACACTGACCCTCCACAGTGTTCTGTCCTCGGCATTGCTTAAGCAGTGAGCGGCTGTCAGGACCCACTGGTCGGAGATGAGGGCCCCCCGGCAGGTCTCCTGGCTCTTGGGCTGCAGGGGGACAGGGAATCTCGGGGACTGCTATGTCTCTGGCTTGTGGCCACACCTCTGG
19 PMC2566321.S2.doc CATCATTGCAATCAAGTGGAGACAGAAGTGGTGGGAGACGTGACTTATACGACCCACAGGGACTGCTGCGTTGGTGACCTGTGCAACGGTGCTGTGGCGAGCACTGCAGCCCCCATGAGCATCGTGGCTGCAGCAGTCACCACGCTGGCCTGTCTCTTGCCAGGACTGTGcCTCTGCGTTTTGAGCCATACGAGGCAGTGGCTCTGGCCTCAGGAGGAGAAGTGATTTTCACCGAAGACCAGTATATTCAGGATGTGGCGGCCATTGTTGGGGAGAGCATGGA
20 PMC2566321.S2.doc CATAGCTCTTTGGGGGACACCCTCGTAGTGAGGAGACCCTGCCCAAGGCCAACCCTGACTCCCTGGAGACTGCTGGCCCCTCATCCCCAGCCTCTGTCACGGTCACTGTCGGCGATGAGGGGGCTGACACCCCTGTAGGGCCACACCACTCATTGGGGATGAACCTGAGAACCTTGAGGGAGATGG
21 PMC2566321.S2.doc CCATCTCCCTCAAGGTTCTCAGGTTCATCCCCAATGAGTGGTGTGGCCCCTACAGGGGTGTCAGCCCCCTCATCGCCGACAGTGACCGTGACAGAGGCTGGGGATGAGGGGCCAGCAGTCTCCAGGGAGTCAGGGTTGGCCTTGGGCAGGGTCTCCTCACTACGAGGGGTGTCCCCAAAGAGCTATGAAA
22 PMC2566321.S2.doc TAtGAGGGACAGAACtGCTCAAAGGAACCaGACGCGTGTcAATCCCAGCcCTGTCACAACCAGGGGACCTGCACCTCCAAACCCGGAGGCTTCCACTGTGCCTGCCCGCCGGCTTTTGTGGGGCTGCGCTGTGAGGGGGACGTGGATGAGTGTCTGGACcGGCcCTGTCAcCCCACAGGCACTGCAGCCTGCCATTCTCTGGCCAACGCCTTCTACTGCCAGTGTCTgCCTGGACACACAG
23 PMC2566321.S2.doc ACTTTATTTCTCGCCACTGACCAGTAGGCGGTTACAGGCATGACTCCCCTGGGGAGCGGAGGTTCAGTGATGTAGCGACAAATCAGTCACCAAATCAGCATCATTTAGACAACTTG
24 PMC2566321.S2.doc TGGCAGAGAACGATGTGGACAATGTCATAGTCCAAGAGCTCATTGTCC
25 PMC2566321.S2.doc GAAGCAGGTCATGATGTTCAGTGCCTCTTTGCTCAAGGTAGCACTGAA
26 PMC2566321.S2.doc CTGTTCATGACCGGAATGCCAACACCAACCATGACATAGCTGTTGGCA
27 PMC2566321.S2.doc AAGGTTCCAACCACGACATAGCTGATGACCGGAATGCCAACAGCTATG
28 PMC2566321.S2.doc CTTCTCTTCCTGCCTTTTCTCCTCCACACTGAACCGCAGGGAGGAGAACATGGGAGGCTTTCACAAAGAACAGAGGAGCCTTCGAGGATTTCTCTGTTCCAAGCAGTGAGCGGCTGTCAGGACCTCATCTCCGACCAGTGGGTCCTGAC
29 PMC2566321.S2.doc AATCCATGACTCCTGCATGGCATGCACCCCAGATTGTATGCATGCCATCAGATGGTTCCTATGGGGCTTGGTTGCTACTATCCCGATGTAACCAAGCG
30 PMC2566321.S2.doc GCAATCAAGTGGAGACAGAAGTGGTAAGTCACGTCTCCCACCACTTCTGCTCACCGAAGACCAGTATATTCAGGACAATGGCCGCCACATCCTGAATA
31 PMC2566321.S2.doc TGTCCATCCTGACGATCGACGACGTTCACCTCGAAGATGCCGTCGTCG
32 PMC2566321.S2.doc AGCAGGAGGGGCAGGAGTATTGGGAATCGCGTCTCCTGATCCCAATAC
33 PMC2566321.S2.doc GACGAGGTTTCATTTTCAGTTTGGCACGCGGTGATTAAACCCAAACTG
34 PMC2566321.S2.doc ATTCATGGTTCTGGCCCCACCTCTTCTCAAGCTTCTCCAGAGAGGTGG
35 PMC2566321.S2.doc ATCTCCCTCAAGGTTCTCAGGTTCACCACTCATTGGGGATGAACCTGA
36 PMC2566321.S2.doc CAGAACTGCTCAAAGGAACCAGACGCTGGGATTGACACGCGTCTGGTT
37 PMC2566321.S2.doc TAGAGCCTTCATCACCACCTTGTGCCAGTTGCAATATCTGCACAAGGT
38 PMC2566321.S2.doc TGCAGAGAGGCTTACAGAGCCATCCCTGAGACATCACTCAGATGGCTC
39 PMC2566321.S2.doc ATTTCTCGCCACTGACCAGTAGGCAGTCATGCCTGTAACCGCCTACTG
40 PMC2566321.S2.doc TACCTCATCTACTCCCAGGTCCTCAGCCTTGGCCTTTGAAGAGGACCT
41 PMC2566321.S2.doc CACCTACTTTCCAGGTATTCCAGCTTTCCATCCATGCGGCGCTGGAAT
Display recognized sequences in FASTA format