text2genome

About us

Related Links

Press Coverage

PubMed: 19451263    PubMedCentral: PMC2715066

Deficiency of the DNA repair enzyme ATM in rheumatoid arthritis.

Shao L, Fujii H, Colmegna I, Oishi H, Goronzy JJ, Weyand CM
The Journal of experimental medicine, 1435 , 2009

Abstract:

In rheumatoid arthritis (RA), dysfunctional T cells sustain chronic inflammatory immune responses in the synovium. Even unprimed T cells are under excessive replication pressure, suggesting an intrinsic defect in T cell regeneration. In naive CD4 CD45RA(+) T cells from RA patients, DNA damage load and apoptosis rates were markedly higher than in controls; repair of radiation-induced DNA breaks was blunted and delayed. DNA damage was highest in newly diagnosed untreated patients. RA T cells failed to produce sufficient transcripts and protein of the DNA repair kinase ataxia telangiectasia (AT) mutated (ATM). NBS1, RAD50, MRE11, and p53 were also repressed. ATM knockdown mimicked the biological effects characteristic for RA T cells. Conversely, ATM overexpression reconstituted DNA repair capabilities, response patterns to genotoxic stress, and production of MRE11 complex components and rescued RA T cells from apoptotic death. In conclusion, ATM deficiency in RA disrupts DNA repair and renders T cells sensitive to apoptosis. Apoptotic attrition of naive T cells imposes lymphopenia-induced proliferation, leading to premature immunosenescence and an autoimmune-biased T cell repertoire. Restoration of DNA repair mechanisms emerges as an important therapeutic target in RA.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:472/ATM
Genes found in fulltext (GNAT)
EntrezGene:10111/RAD50
EntrezGene:4683/NBN
EntrezGene:472/ATM
EntrezGene:672/BRCA1
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNF ENSG00000204490 0,1
TNF ENSG00000206439 0,1
TNF ENSG00000223952 0,1
TNF ENSG00000228321 0,1
TNF ENSG00000228849 0,1
TNF ENSG00000230108 0,1
TNF ENSG00000232810 0,1
TP53 ENSG00000141510 3,2
MRE11A ENSG00000020922 5,4
NBN ENSG00000104320 6,7
RAD50 ENSG00000113522 8,9
BRCA1 ENSG00000012048 10,11

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr6:31545292-31545474
0, 1 HSCHR6_MHC_SSTO:31535235-31535417
0, 1 HSCHR6_MHC_APD:31556613-31556795
2, 3 chr17:7579495-7590844
0, 1 HSCHR6_MHC_MANN:31584779-31584961
5 chr11:94192705-94192725
0, 1 HSCHR6_MHC_DBB:31527436-31527618
8, 9 chr5:131973878-131977913
5 chr3:155830305-155830325
10, 11 chr17:41234426-41242995
0, 1 HSCHR6_MHC_QBL:31535535-31535717
0, 1 HSCHR6_MHC_MCF:31621601-31621783
6, 7 chr8:90990462-90993105
0, 1 HSCHR6_MHC_COX:31532704-31532886

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2715066.pdf CTTTGGGATCATTGCCCTGTG
1 PMC2715066.pdf CGAAGTGGTGGTCTTGTTGCT
2 PMC2715066.pdf CATGTGCTCAAGACTGGCGC
3 PMC2715066.pdf GGAGCTTCATCTGGACCTGG
4 PMC2715066.pdf CTTGTACGACTGCGAGTGGA
5 PMC2715066.pdf TTCACCCATCCCTCTTTCTG
6 PMC2715066.pdf TTGGTTGCATGCTCTTCTTG
7 PMC2715066.pdf GGCTGCTTCTTGGACTCAAC
8 PMC2715066.pdf CTTGGATATGCGAGGACGAT
9 PMC2715066.pdf CCAGAAGCTGGAAGTTACGC
10 PMC2715066.pdf GGCTATCCTCTCAGAGTGACA
11 PMC2715066.pdf CTGATGTGCTTTGTTCTGGA
12 PMC2715066.pdf AGGAATTCCCAGTAAGTGCG
13 PMC2715066.pdf GCCTCACTAAACCATCCAA
Display recognized sequences in FASTA format