text2genome

About us

Related Links

Press Coverage

PubMed: 19125187    PubMedCentral: PMC2607029

Toll-like receptors and cytokines as surrogate biomarkers for evaluating vaginal immune response following microbicide administration.

Gupta SM, Aranha CC, Mohanty MC, Reddy KV
Mediators of inflammation, , 2008

Abstract:

Topical microbicides are intended for frequent use by women in reproductive age. Hence, it is essential to evaluate their impact on mucosal immune function in the vagina. In the present study, we evaluated nisin, a naturally occurring antimicrobial peptide (AMP), for its efficacy as an intravaginal microbicide. Its effect on the vaginal immune function was determined by localizing Toll-like receptors (TLRs-3, 9) and cytokines (IL-4, 6 , 10 and TNF-alpha) in the rabbit cervicovaginal epithelium following intravaginal administration of high dose of nisin gel for 14 consecutive days. The results revealed no alteration in the expression of TLRs and cytokines at both protein and mRNA levels. However, in SDS gel-treated group, the levels were significantly upregulated with the induction of NF-kappaB signalling cascade. Thus, TLRs and cytokines appear as sensitive indicators for screening immunotoxic potential of candidate microbicides.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:3565/IL4
EntrezGene:54106/TLR9
EntrezGene:7098/TLR3
EntrezGene:7099/TLR4
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF

Best predicted genome from sequences: Oryctolagus cuniculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNFA_RABIT ENSOCUG00000006698 6,7

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2 scaffold_200225:37189-37305
0 GeneScaffold_1817:130311-130333
14, 15 GeneScaffold_3532:57062-57405
13 scaffold_95086:1086-1109
14, 15 scaffold_212581:41291-41622
7 GeneScaffold_6795:38720-38742
12 scaffold_175053:31373-70563
14, 15 GeneScaffold_1266:4861-5204
14, 15 scaffold_86324:986-1316
14, 15 GeneScaffold_2557:332477-332822

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2607029.pdf AGTTCTACCTCCACCACAAGGT
1 PMC2607029.pdf TCAGCTCTGACGCTTTGAGTAT
2 PMC2607029.pdf AGGAGCTGAGGAAAGAGATGTG
3 PMC2607029.pdf TGTTTTCTTCGTCACTCCTGAA
4 PMC2607029.pdf TTCTTTCAATCGAAGGATCAGC
5 PMC2607029.pdf CTCATTCATGGCTTTGTAGACG
6 PMC2607029.pdf CTAGCCCACGTAGTAGCAAACC
7 PMC2607029.pdf GCTGAAGAGAACCTGGGAGTAG
8 PMC2607029.pdf GATCTGTCTCATAATGGCTTG
9 PMC2607029.pdf GACAGATTCCGAATGCTTGTG
10 PMC2607029.pdf TTCCCTGTAGCTGCTGTCC
11 PMC2607029.pdf ACAGCCAGTTGCAGTTCACC
12 PMC2607029.pdf CTCTGCTTGCTGCCATTCTC
13 PMC2607029.pdf AATCGTCTGCAAGTACAGGACAC
14 PMC2607029.pdf CCATTCATTGACCTCCACTACA
15 PMC2607029.pdf CGTTGCTGACAATCTTGAGAGA
Display recognized sequences in FASTA format