text2genome

About us

Related Links

Press Coverage

PubMed: 19922606    PubMedCentral: PMC2783035

Retinoic acid inducible gene I activates innate antiviral response against human parainfluenza virus type 3.

Sabbah A, Bose S
Virology journal, 200 , 2009

Abstract:

Human parainfluenza virus type 3 (HPIV3) is a respiratory paramyxovirus that infects lung epithelial cells to cause high morbidity among infants and children. To date, no effective vaccine or antiviral therapy exists for HPIV3 and therefore, it is important to study innate immune antiviral response induced by this virus in infected cells. Type-I interferons (IFN, interferon-alpha/beta) and tumor necrosis factor-alpha (TNFalpha activated by NFkappaB) are potent antiviral cytokines that play an important role during innate immune antiviral response. A wide-spectrum of viruses utilizes pattern recognition receptors (PRRs) like toll-like receptors (TLRs) and RLH (RIG like helicases) receptors such as RIGI (retinoic acid inducible gene -I) and Mda5 to induce innate antiviral response. Previously it was shown that both TNFalpha and IFNbeta are produced from HPIV3 infected cells. However, the mechanism by which infected cells activated innate response following HPIV3 infection was not known. In the current study, we demonstrated that RIGI serves as a PRR in HPIV3 infected cells to induce innate antiviral response by expressing IFNbeta (via activation of interferon regulatory factor-3 or IRF3) and TNFalpha (via activation of NF-kappaB).

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:23586/DDX58
Genes found in fulltext (GNAT)
EntrezGene:142980/Tlr3
EntrezGene:23586/DDX58
EntrezGene:2597/GAPDH
EntrezGene:3661/IRF3
EntrezGene:4615/MYD88
EntrezGene:51284/TLR7
EntrezGene:57120/GOPC
EntrezGene:57506/MAVS
EntrezGene:64135/IFIH1
EntrezGene:7098/TLR3
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:9636/ISG15

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
GAPDH ENSG00000111640 0,1
IFNB1 ENSG00000171855 2,3
TNF ENSG00000204490 4,5
TNF ENSG00000206439 4,5
TNF ENSG00000223952 4,5
TNF ENSG00000228321 4,5
TNF ENSG00000228849 4,5
TNF ENSG00000230108 4,5
TNF ENSG00000232810 4,5
DDX58 ENSG00000107201 6,7

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
5 HSCHR6_MHC_SSTO:31535219-31535250
5 HSCHR6_MHC_COX:31532688-31532719
5 chr6:31545276-31545307
5 HSCHR6_MHC_APD:31556597-31556628
6, 7 chr9:32457279-32473011
5 HSCHR6_MHC_MCF:31621585-31621616
5 HSCHR6_MHC_QBL:31535519-31535550
5 HSCHR6_MHC_MANN:31584763-31584794
2, 3 chr9:21077403-21077589
0, 1 chr12:6646943-6647467
5 HSCHR6_MHC_DBB:31527420-31527451

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2783035.pdf GTCAGTGGTGGACCTGACCT
1 PMC2783035.pdf AGGGGTCTACATGGCAACTG
2 PMC2783035.pdf GATTCATCTAGCACTGGCTGG
3 PMC2783035.pdf CTTCAGGTAATGCAGAATCC
4 PMC2783035.pdf GAGTGACAAGCCTGTAGCCCATGTTGTAGCA
5 PMC2783035.pdf GCAATGATCCCAAAGTAGACCTGCCCAGACT
6 PMC2783035.pdf GCATATTGACTGGACGTGGCA
7 PMC2783035.pdf CAGTCATGGCTGCAGTTCTGTC
Display recognized sequences in FASTA format